SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
How to put header back to .bam file? eilosei Bioinformatics 6 02-06-2014 05:22 PM
how to construct phylogenetic tree using SNPs tianyub836 Bioinformatics 10 05-21-2013 06:27 AM
Tmap: how to use it to construct genetic map with large-scale SNP markers orctyr Bioinformatics 0 03-16-2011 01:11 AM
construct whole genome reference for HG19 foxyg Bioinformatics 3 09-08-2010 01:12 PM
Convert Maq's out put to fasta/fastq? bea Bioinformatics 5 06-04-2009 01:18 AM

Reply
 
Thread Tools
Old 07-05-2012, 09:14 AM   #21
ThePhotosyntheticMan
Junior Member
 
Location: North Carolina

Join Date: Jul 2012
Posts: 2
Default

Quote:
Originally Posted by TonyBrooks View Post
I think both should work.
The Illumina read primer is actually a primer mix of several primers. I guess there's probably primers for both sequences in there (TruSeq and Nextera).

However, if you're generating library directly from PCR, why not remove those sequences all together and just use custom read primers. Your custom read primers will just be versions of your fwd and rev primer sequences. You'll also waste less reagent by not sequencing your primers. See my post further up.
Got it. Thanks!
ThePhotosyntheticMan is offline   Reply With Quote
Old 07-11-2012, 06:11 AM   #22
gnomers
Junior Member
 
Location: Toronto

Join Date: Dec 2009
Posts: 4
Default

Quote:
Originally Posted by TonyBrooks View Post
I think both should work.
The Illumina read primer is actually a primer mix of several primers. I guess there's probably primers for both sequences in there (TruSeq and Nextera).

However, if you're generating library directly from PCR, why not remove those sequences all together and just use custom read primers. Your custom read primers will just be versions of your fwd and rev primer sequences. You'll also waste less reagent by not sequencing your primers. See my post further up.
We've been using custom read primers on an amplicon library successfully on the HiSeq. However, we just tried the exact same strategy on the MiSeq and it failed utterly (nothing but PhiX in the first (index) read.)

Are the annealing temperatures very different on the HiSeq and MiSeq?
gnomers is offline   Reply With Quote
Old 07-11-2012, 06:30 AM   #23
TonyBrooks
Senior Member
 
Location: London

Join Date: Jun 2009
Posts: 287
Default

See this document (taken from an Illumina bulletin on their website).
TonyBrooks is offline   Reply With Quote
Old 07-26-2012, 03:48 PM   #24
uberfinch
Junior Member
 
Location: boston

Join Date: Dec 2011
Posts: 8
Default MiSeq fail with Nextera adapters

I used the following adapters on our MiSeq:

N701:
CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG

N501:
AATGATACGGCGACCACCGAGATCTACACTAGATCGCTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG

It didn't detect clusters (I used the provided sequencing primers).

Anyone have any ideas of what went wrong? I'm dumbfounded.
uberfinch is offline   Reply With Quote
Old 07-27-2012, 03:45 AM   #25
pmiguel
Senior Member
 
Location: Purdue University, West Lafayette, Indiana

Join Date: Aug 2008
Posts: 1,863
Default

Quote:
Originally Posted by uberfinch View Post
I used the following adapters on our MiSeq:

N701:
CAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG

N501:
AATGATACGGCGACCACCGAGATCTACACTAGATCGCTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG

It didn't detect clusters (I used the provided sequencing primers).

Anyone have any ideas of what went wrong? I'm dumbfounded.
I guess I don't understand your strategy.
Looks to me like clusters should have formed, but I don't see anywhere for the standard sequencing primers to anneal. Which would make the clusters undetectable unless you added custom sequencing primer. If you did add custom sequencing primer, does it have an annealing temp of 65 oC (or higher)? The Illumina document that Tony attached above points out that primers with lower annealing temps might not work.

Eg, your i5 adapter:

AATGATACGGCGACCACCGAGATCTACA | CTAGATCG | CTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
Flow cell binding----------- | index??? | ?____________________what is this?


Oh wait, that is the old Nextera transposase sequence. Guess Illumina does not include it in their standard i5 primer cocktail. You would have to spike it in.

--
Phillip

Last edited by pmiguel; 07-27-2012 at 03:55 AM.
pmiguel is offline   Reply With Quote
Old 07-27-2012, 04:10 AM   #26
uberfinch
Junior Member
 
Location: boston

Join Date: Dec 2011
Posts: 8
Default

Thanks for your reply Philip. Yes, as you surmised those 19 bp on the end are the nextera sequence taken from the sequence reported in Illumina's letter for version 2. To make absolutely sure it was right I TOPO cloned a library made with the Nextera XT kit that is supposedly compatible with the miseq on got that exact adapter sequence.

Is there any reason to believe the PCR primers for nextera are somehow modified?
uberfinch is offline   Reply With Quote
Old 07-27-2012, 04:26 AM   #27
pmiguel
Senior Member
 
Location: Purdue University, West Lafayette, Indiana

Join Date: Aug 2008
Posts: 1,863
Default

PCR primers? No.
It is the internal segment, closest to the "insert" that has been replaced in the Illumina Nextera kits.
Details in the "Illumina Customer Sequence Letter".
Again, I think you probably did get clusters on your flow cell. They just were invisible because Illumina sequencers only detect clusters to which a read1 sequencing primers can anneal.

--
Phillip
pmiguel is offline   Reply With Quote
Old 07-27-2012, 04:29 AM   #28
pmiguel
Senior Member
 
Location: Purdue University, West Lafayette, Indiana

Join Date: Aug 2008
Posts: 1,863
Default

Quote:
Originally Posted by uberfinch View Post
To make absolutely sure it was right I TOPO cloned a library made with the Nextera XT kit that is supposedly compatible with the miseq on got that exact adapter sequence.
Are you sure it was a Nextera XT kit, not an old (possibly Epicentre) Nextera kit that you topo cloned and Sanger sequenced?

--
Phillip
pmiguel is offline   Reply With Quote
Old 07-27-2012, 09:26 AM   #29
uberfinch
Junior Member
 
Location: boston

Join Date: Dec 2011
Posts: 8
Default

Yes, I'm positive it is a Nextera XT kit (just bought it!). If you look on the illumina letter, those sequences are from the Illumina V.2 nextera kits.

Anyway I guess there isn't a good explanation for why it didn't work. Maybe I'll just have to risk burning another kit! There's only so many times you can stare at the sequences looking for an error.
uberfinch is offline   Reply With Quote
Old 07-27-2012, 10:52 AM   #30
pmiguel
Senior Member
 
Location: Purdue University, West Lafayette, Indiana

Join Date: Aug 2008
Posts: 1,863
Default

Okay, my mistake. Your adapters should be fine.
Is this just a normal NexteraXT kit library, or a set of amplicons you constructed in another manner to mimic the structure of a Nextera library?

We just did a MiSeq run on a NexteraXT library (our first Nextera run). It worked. I even spiked in 30% phiX, just in case. (Denature the normal, NaOH way, diluted to 8pM and mixed 30:70 vol:vol with the heat denatured NexteraXT library.)

Actually, that was our second Nextera run. We ran the same library (no phiX) the previous day on another MiSeq and it terminated prematurely (crashed) without imaging apparently. Maybe I should have mentioned this earlier? But I was pretty sure this was a fluidics issue because the instrument failed a subsequent volume test.

--
Phillip
pmiguel is offline   Reply With Quote
Old 01-07-2014, 02:41 AM   #31
krispy
Junior Member
 
Location: Singapore

Join Date: Apr 2013
Posts: 7
Default

Hi all,

I am not sure if I should ask it here, still new to NGS, and I have lots of questions that I couldn't figured out.

1) I am using a custom adapter (that contains p5 p7 for flow cell binding), custom sequencing primer and also a custom index i7 primer for my work. I come across this dual-indexing, I am just wondering if it is possible to have a custom index i5 primer?

2) I am not familiar with Nextera, why is the dark cycles necessary? why not just custom make an index i5 primer that spam the 7bp constant read and read directly into the index? or wait did I miss out something. where is this index i5 primer primed from?

3) must it be index read 1 = i7 index; index read 2 = i5 index? can't be other way round? it's still on the same strand right?

sorry if I asked too many of the dumb questions.

cheers.
krispy is offline   Reply With Quote
Old 01-07-2014, 03:13 AM   #32
TonyBrooks
Senior Member
 
Location: London

Join Date: Jun 2009
Posts: 287
Default

1) You should be able to design an i5 index primer/adaptor
2) The i5 index is primed and read from the P5' oligo that's grafted onto the flowcell for clustering. No custom read primer is needed. However, due to the way linearisation is performed during cluster-gen. 7 dark cycles are needed to extend this oligo until the i5 index is reached. See page 7 of this document (http://supportres.illumina.com/docum...15032071_b.pdf)
3) Read sequence goes as follows: Read 1, i7 index, i5 index, Read 2. Everything but read 2 is read off of one strand (to allow for dual indexing on single read runs without the need to resynthesise the second strand).
TonyBrooks is offline   Reply With Quote
Old 02-20-2014, 09:53 AM   #33
creeves
Member
 
Location: East Bay

Join Date: Jul 2012
Posts: 24
Default High multiplexing of Nextera libraries

I would like to reopen this thread, as we have successfully run a pool of over 1400 samples (plasmids) on a MiSeq using our own i5 and i7 index primers. We reduced the volume of tagmentation considerably and developed a PCR protocol to attach unique combinations of our own i5 and i7 primers to each sample. The MiSeq had no trouble demultiplexing these 1400 samples. We hope to publish the methods soon. However, we have since tried running over 4000 samples in a pool and here the MiSeq had big trouble demultiplexing. Has anyone out there tried such high levels of multiplexing? If so, I would like to hear about your experience.
creeves is offline   Reply With Quote
Old 02-20-2014, 10:13 AM   #34
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 3,002
Default

Quote:
Originally Posted by creeves View Post
However, we have since tried running over 4000 samples in a pool and here the MiSeq had big trouble demultiplexing. Has anyone out there tried such high levels of multiplexing? If so, I would like to hear about your experience.
You should be doing the demultiplexing off-line using bcl2fastq/CASAVA when you are doing something so outside "normal"

What was the length of the tag reads BTW.
GenoMax is offline   Reply With Quote
Old 02-20-2014, 11:59 AM   #35
koadman
Member
 
Location: Sydney, Australia

Join Date: May 2010
Posts: 63
Default

Well done creeves on pushing the multiplexing so far. What was the edit distance between your barcodes? The default parameters for demultiplexing tolerate 1 mismatch in each barcode I believe. If some of the barcodes have an edit distance less than 2 you might need to demultiplex looking for exact barcode matches.
koadman is offline   Reply With Quote
Old 02-20-2014, 12:10 PM   #36
creeves
Member
 
Location: East Bay

Join Date: Jul 2012
Posts: 24
Default Bar codes

The 8-base i5 and i7 indices had a Hamming distance of at least three from all others.
creeves is offline   Reply With Quote
Old 02-20-2014, 02:38 PM   #37
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 3,002
Default

Was this V2/V3 chemistry and what was the cluster concentration? I wonder if the problems you are having are because of overloading and not number of samples.
GenoMax is offline   Reply With Quote
Old 02-20-2014, 10:58 PM   #38
Vinz
Member
 
Location: Germany

Join Date: Dec 2010
Posts: 69
Default

We have done up to 1536 multiplexing in a run so far. Demultiplexing by the MiSeq software worked well.
However, there is a bug in the current RTA version: There is a timeout for writing fastqs in the output folder. For large V3 runs with many samples, part of the fastqs do not end up in the output folder. They are however in the analysis folder.

Meanwhile we published our dual indexing strategy - in case anyone is interested:
BMC Genomics - Cost-efficient high-throughput HLA typing by MiSeq amplicon sequencing
Vinz is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:46 PM.


Powered by vBulletin® Version 3.8.6
Copyright ©2000 - 2014, Jelsoft Enterprises Ltd.