SEQanswers

Go Back   SEQanswers > Introductions



Similar Threads
Thread Thread Starter Forum Replies Last Post
Mate pairs processing Antony03 Bioinformatics 5 10-30-2013 10:14 AM
How are mate pairs formed and stored ashutosh Illumina/Solexa 5 05-24-2013 10:04 AM
Orientation of mate-pairs JackieBadger Bioinformatics 6 09-18-2012 05:07 PM
Mate pairs in ABySS VNou Bioinformatics 0 06-29-2012 06:57 AM
454 mate pairs and mosaik afb Bioinformatics 4 04-02-2010 05:07 AM

Reply
 
Thread Tools
Old 12-20-2016, 01:05 PM   #1
MicroMicro
Junior Member
 
Location: CT

Join Date: Jul 2016
Posts: 2
Default Hey, let's talk about mate pairs and MiSeq

Hi all, I'm new to posting but have been using this site for reference for about a year now.

I'm analyzing a bacterial genome sequenced on a MiSeq for a lab that's unfamiliar with sequencing and bioinformatics. So, first up, does anyone have tips for figuring out if a run has been done with paired ends by looking at the data?

Second, does all MiSeq data have mate pairs? Illumina's website doesn't explicitly state this. Does anyone know of a good, LABLED figure illustrating this?

Last edited by MicroMicro; 12-20-2016 at 01:08 PM.
MicroMicro is offline   Reply With Quote
Old 12-20-2016, 03:16 PM   #2
Brian Bushnell
Super Moderator
 
Location: Walnut Creek, CA

Join Date: Jan 2014
Posts: 2,669
Default

MiSeq can produce paired or unpaired data depending on the run configuration. Paired data is pretty easy to spot - there will either be two output fastq files (typically with identical names except for "R1" or "R2" near the end of the name), or else there will be one file interleaved. For an interleaved file, the names of the first two reads will be identical except that after the first whitespace, one will have "1:" and the other "2:". For example, this is the first 4 lines of an interleaved NextSeq fastq:

Code:
@NS500302:178:HLNGJBGXY:1:11101:23298:1057 1:N:0:GTAGAG
TATGGNCGAGAGCCGCAGGCAATAACAANTTNTTNAGCGGTTAGTGTTTCAACGCTGCCGTCCGGGCAATCCAGCGCCAACGTATGCTCGTCAACAAAGCGAGCGTTTCCCTGCAATATTTCACAGTGATTACGTTCGTAAAATCCCTGAC
+
@[email protected]!FF!FF!FFCFFFFFFFFFFFCFDFFCFFFFFFFFFFFFFFFFFEEFDFFFFFFFFFFFFEFFFDFFF<FEEECEBDEEFDDDFEEFFFFFCFBCD?DFECFFFEE=FFFFFFEFFF=EFFAB
@NS500302:178:HLNGJBGXY:1:11101:23298:1057 2:N:0:GTAGAG
TGCTCCGCTCTTCTTTTGCCGATATCCTTAACCATGCCGATAACGTGATTAATCAACAAACGCGCATGCGTCAGGGATTTTACGAACGTAATCACTGTGAAATATTGCAGGGAAACGCTCGCTTTGTTGACGAGCATACGTTGGCGCTGGA
+
@@CCCFFFFFFFFFEFFFFFFFFFFFFFFFEFFFFFFFFFFFFFFFFFFFFEFFFFFFFEFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF<EFFFFAFFFFFFFFFFFFFFFFF?FEFFFFFFFFFFFFFFFFFFFFFEEFFADBBFF
Brian Bushnell is offline   Reply With Quote
Old 12-21-2016, 08:17 AM   #3
MicroMicro
Junior Member
 
Location: CT

Join Date: Jul 2016
Posts: 2
Default

Thanks Brian! I have two files so that clears things up considerably.

Still looking for a good figure if anyone out there has one
MicroMicro is offline   Reply With Quote
Old 12-21-2016, 08:42 AM   #4
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,440
Default

Mate-pair has a certain meaning (which is not the same as paired-end reads). Sequence is always represented as 5' --> 3' for R1 and R2.

Simply R1 - R2 files represent fragment(s) sampled from the two ends.
Code:
R1  ------------------->
     -------------------------------------------------------  DNA Fragment
                                             <--------------   R2
GenoMax is offline   Reply With Quote
Old 12-21-2016, 08:48 AM   #5
ronaldrcutler
Member
 
Location: Virginia

Join Date: May 2016
Posts: 80
Default

Figures 6B and 6C should answer the mate pair question: http://www.illumina.com/documents/pr...c_sequence.pdf
ronaldrcutler is offline   Reply With Quote
Old 12-22-2016, 05:20 AM   #6
thermophile
Senior Member
 
Location: CT

Join Date: Apr 2015
Posts: 195
Default

Ask the lab what library construction kit they used. I doubt it would be mate pair if this is their first library-more likely something like nextera or truseq which are paired end sequencing of ~350-550 bp fragments
__________________
Microbial ecologist, running a sequencing core. I have lots of strong opinions on how to survey communities, pretty sure some are even correct.
thermophile is offline   Reply With Quote
Reply

Tags
miseq amplicon

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 12:30 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2017, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO