
Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa

Similar Threads
Thread Thread Starter Forum Replies Last Post
trim adapter from Illumina Genome Analyzer IIe miRNA reads NicoBxl Bioinformatics 5 01-02-2014 05:31 AM
Illumina Adapter and Primer preparation S.Iyengar Sample Prep / Library Generation 7 11-04-2013 07:08 AM
primer/adapter sequences nikiwilson Sample Prep / Library Generation 2 06-21-2011 01:36 PM
what's the different between Illumina Genome Analyzer biocc Illumina/Solexa 3 06-03-2010 11:28 PM
A clarification for Illumina/Solexa Genome Analyzer Primer/Adapter Sequences kaichen Illumina/Solexa 1 08-06-2009 05:57 PM

Thread Tools
Old 04-07-2008, 07:53 AM   #1
--Site Admin--
Location: SF Bay Area, CA, USA

Join Date: Oct 2007
Posts: 1,352
Default Illumina/Solexa Genome Analyzer Primer/Adapter Sequences

The following sequences were obtained from here (**):

Sequences for Solexa Library Preparations:

Genomic DNA oligonucleotide sequences

Adapters 1

PCR Primers 1

Genomic DNA Sequencing Primer

DpnII gene expression oligonucleotide sequences

Gex Adapter 1

Gex Adapter 2

Gex PCR Primer 1

Gex PCR Primer 2

Gex Sequencing Primer

NlaIII gene expression oligonucleotide sequences

Gex Adapter 1

Gex Adapter 2

Gex PCR Primer 1

Gex PCR Primer 2

Gex Sequencing Primer

Small RNA oligonucleotide sequences

RT Primer

5' RNA Adapter

3' RNA Adapter

Small RNA PCR Primer 1

Small RNA PCR Primer 2

Small RNA Sequencing Primer

**disclaimer blah blah blah. We take no responsibility if you blow a flow cell using these sequences!
ECO is offline   Reply With Quote
Old 04-09-2008, 03:58 AM   #2
Location: Sydney, Australia

Join Date: Jan 2008
Posts: 83

Bravo! Just what I needed.
sci_guy is offline   Reply With Quote
Old 04-10-2008, 03:37 AM   #3
Junior Member
Location: Hefei, China

Join Date: Feb 2008
Posts: 6

Very useful!
I refined these sequences. Hopes they're clearer.

Genomic DNA

5' -------------------- -----ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------- 3'
3' -------------------- -----TGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGp (-) -------------------- -------------- 5'
5' -------------------- -------------------- ------------------ (-) pGATCGGAAGAGCTCGTATG CCGTCTTCTGCTTG 3'
3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGAGCATAC GGCAGAAGACGAAC 5'
PCR Primer:
3' -------------------- -------------------- ------------------ (-) -------------------- -------------- 5'
PCR Primer:
5' -------------------- -------------------- ------------------ (-) -------------------- -------------- 3'
3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGAGCATAC GGCAGAAGACGAAC 5'
Result Library:
Genomic DNA Sequencing Primer:
5' -------------------- -----ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------- 3'
3' -------------------- -------------------- ------------------ (-) -------------------- -------------- 5'

DpnII gene expression

Gex Adapter 1:
5' -------------------A CAGGTTCAGAGTTCTACAGT CCGAC--------------- -------------------- ------ 3'
3' -------------------- ---CAAGTCTCAAGATGTCA GGCTGCTAGp---------- -------------------- ------ 5'
Gex Adapter 2:
5' -------------------- -------------------- -------------------- ----pTCGTATGCCGTCTTC TGCTTG 3'
3' -------------------- -------------------- -------------------- ---NNAGCATACGGCAGAAG ACGAAC 5'
Gex PCR Primer 1:
5' -------------------- -------------------- ----------------------------------------- ------ 3'
3' -------------------- -------------------- -------------------- -----AGCATACGGCAGAAG ACGAAC 5'
Gex PCR Primer 2:
5' AATGATACGGCGACCACCGA CAGGTTCAGAGTTCTACAGT CCGA---------------- -------------------- ------ 3'
3' -------------------- -------------------- -------------------- -------------------- ------ 5'
Result Library:
Gex Sequencing Primer:
5' -----------------CGA CAGGTTCAGAGTTCTACAGT CCGACGATC----------- -------------------- ------ 3'
3'--------------------- -------------------- -------------------- -------------------- ------ 5'

NlaIII gene expression

Gex Adapter 1:
5' -------------------A CAGGTTCAGAGTTCTACAGT CCGACATG------------ -------------------- ------ 3'
3' -------------------- ---CAAGTCTCAAGATGTCA GGCTp--------------- -------------------- ------ 5'
Gex Adapter 2:
5' -------------------- -------------------- -------------------- ----pTCGTATGCCGTCTTC TGCTTG 3'
3' -------------------- -------------------- -------------------- ---NNAGCATACGGCAGAAG ACGAAC 5'
Gex PCR Primer 1:
5' -------------------- -------------------- -------------------- -------------------- ------ 3'
3' -------------------- -------------------- -------------------- -----AGCATACGGCAGAAG ACGAAC 5'
Gex PCR Primer 2:
5' AATGATACGGCGACCACCGA CAGGTTCAGAGTTCTACAGT CCGA---------------- -------------------- ------ 3'
3' -------------------- -------------------- -------------------- -------------------- ------ 5'
Result Library:
Gex Sequencing Primer:
5' ----------------CCGA CAGGTTCAGAGTTCTACAGT CCGACATG------------ -------------------- ------ 3'
3' -------------------- -------------------- -------------------- -------------------- ------ 5'

Small RNA

5' RNA Adapter:
5' -------------------- ---GUUCAGAGUUCUACAGU CCGACGAUC (-) -------------------- - 3'
3' -------------------- -------------------- --------- (-) -------------------- - 5'
3' RNA Adapter:
5' -------------------- -------------------- --------- (-)pUCGUAUGCCGUCUUCUGCUU GUidT 3'
3' -------------------- -------------------- --------- (-) -------------------- - 5'
RT Primer:
5' -------------------- -------------------- --------- (-) -------------------- - 3'
3' -------------------- -------------------- --------- (-) AGCATACGGCAGAAGACGAA C 5'
Small RNA PCR Primer 1:
5' -------------------- -------------------- --------- (-) -------------------- - 3'
3' -------------------- -------------------- --------- (-) AGCATACGGCAGAAGACGAA C 5'
Small RNA PCR Primer 2:
3' -------------------- -------------------- --------- (-) -------------------- - 5'
Result Library:
Small RNA Sequencing Primer:
5' -----------------CGA CAGGTTCAGAGTTCTACAGT CCGACGATC (-) -------------------- - 3'
3' -------------------- -------------------- --------- (-) -------------------- - 5'

Two errors have been corrected. (Genomic DNA Adapter & Small RNA Result Library)
I'm sorry for that and other potential errors.

Last edited by ECO; 10-03-2008 at 05:34 AM. Reason: changed font to courier new
horigen is offline   Reply With Quote
Old 04-10-2008, 08:04 AM   #4
--Site Admin--
Location: SF Bay Area, CA, USA

Join Date: Oct 2007
Posts: 1,352

Thanks Horigen! That definitely clarifies things!

If anyone is having trouble viewing, make sure your browser is as wide as it can go.
ECO is offline   Reply With Quote
Old 05-16-2008, 01:12 AM   #5
Location: germany

Join Date: Apr 2008
Posts: 14

just one question.

We want to synthesize the adapters by ourselves.
Its necessary to phosphorylate the 5' end of the adapters additional?
(there is still no 5' phosphate?)

Thanks a lot!
tec is offline   Reply With Quote
Old 07-15-2008, 11:09 PM   #6
Location: Sydney, Australia

Join Date: Jan 2008
Posts: 83

The P.E adaptors/primers have been added at the original link.
sci_guy is offline   Reply With Quote
Old 09-18-2008, 07:13 PM   #7
Junior Member
Location: Boston

Join Date: Jul 2008
Posts: 3

Sorry for the small font, but that's the only way I could make it fit

Paired-end DNA

PE Adapter1:
5' -------------------- -----ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -----TGTGAGAAAGGGATG TGCTGCGAGAAGGCTAGp (-) -------------------- -------------------- -------------------- - 5'
PE Adapter2:
5' -------------------- -------------------- ------------------ (-) pGATCGGAAGAGCGGTTCAG CAGGAATGCCGAG------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTC------- -------------------- - 5'
PE PCR Primer1:
5' AATGATACGGCGACCACCGA GATCTACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 5'
PE PCR Primer2:
5' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTCTGGCTAG AGCATACGGCAGAAGACGAA C 5'
Result Library:
PE DNA Sequencing Primer1
5' -------------------- -----ACACTCTTTCCCTAC ACGACGCTCTTCCGATCT (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 5'
PE DNA Sequencing Primer2
5' -------------------- -------------------- ------------------ (-) -------------------- -------------------- -------------------- - 3'
3' -------------------- -------------------- ------------------ (-) TCTAGCCTTCTCGCCAAGTC GTCCTTACGGCTCTGGC--- -------------------- - 5'

Last edited by dandestroy; 09-18-2008 at 07:22 PM.
dandestroy is offline   Reply With Quote
Old 10-03-2008, 04:48 AM   #8
Location: Cambridge, MA

Join Date: Aug 2008
Posts: 19

Can someone explain to me why the Illumina adapters need to be 5-phosphorylated? In the very similar SOLiD sample prep protocol the adapters are not phosphorylated.
sigusn is offline   Reply With Quote
Old 10-03-2008, 05:16 AM   #9
Location: Sydney, Australia

Join Date: Jan 2008
Posts: 83

Illumina adaptors need 5' phosphorylation for the ligation. The newer SOLiD protocol uses a "nick translation" like step where the "nick" left over from ligating primers without a 5'-phosphate is translated to (or near enough to) the primer terminus. One strand will ligate as there is a 5' phosphate on the end repaired template DNA. The SOLiD adaptors are blunt-ended on the termini designed for ligation, whereas the Illumina adaptors use a T overhang to create incompatible ends. If the SOLiD primers had 5' phosphate groups there would be a LOT of P1-P2, P1-P1 or P2-P2 ligated product; hence the nick translation like step. Nice clever twist.
sci_guy is offline   Reply With Quote
Old 10-03-2008, 11:31 AM   #10
Junior Member
Location: Michigan

Join Date: Aug 2008
Posts: 2

What conditions do I use to anneal the adapters and what concentration is optimal for ligation of adapters to the fragmented genomic DNA. I am ordering the Illumina primers through Invitrogen. :

Last edited by swaroom; 10-06-2008 at 07:43 AM.
swaroom is offline   Reply With Quote
Old 10-27-2008, 02:51 AM   #11
Jenny Russ
Junior Member
Location: Berlin

Join Date: Sep 2008
Posts: 4
Default mRNA-Seq adapter sequences?

The sequences above are really helpful. Does anyone also have the sequences for mRNA-Seq? This would be really great!!!
Jenny Russ is offline   Reply With Quote
Old 11-14-2008, 01:23 AM   #12
Joanne Ho
Junior Member
Location: Taiwan

Join Date: Nov 2008
Posts: 1

I use PE-adapter to mRNA-seq, it can work properly.
Joanne Ho is offline   Reply With Quote
Old 11-21-2008, 08:19 AM   #13
Location: California

Join Date: May 2008
Posts: 40
Default mRNA-seq adapters

Originally Posted by Jenny Russ View Post
The sequences above are really helpful. Does anyone also have the sequences for mRNA-Seq? This would be really great!!!

mRNA-seq kit uses PE adaptors, and read 1 primer is same as genomic DNA primer for single read sequencing. If you have a PE sample ready, but whatever the reason wants single end sequencing, do that just like for SR sequencing. Done that many times.
monad is offline   Reply With Quote
Old 12-04-2008, 07:30 AM   #14
Junior Member
Location: Germany

Join Date: Dec 2008
Posts: 1

Hello there,

first at all, i want to thank you to all to coperate to give us the sequence of the GEX 1 and 2 adapters and primers for the tag profilling with DpnII , but

does anybody know at which concentration are they used??? The Illumina protocol does not give concentrations. According to the Invitrogen LongSAGE protocol the double stranded adapters have a concentration of 40 ng/ul and 1.5 ul are used for one ligation reaction

thanks a lot,
berthasalco is offline   Reply With Quote
Old 12-08-2008, 07:43 AM   #15
Senior Member
Location: USA

Join Date: Jan 2008
Posts: 482

Hi all,

Thanks for the technical details on this. Anyone got some information about bioinformatics on adapter contamination detection and removal. I tried using adapter sequences with eland to check for contamination, but less than 1% reads aligned. I expected more as less than 10% reads aligned to actual reference.

I know of a file one can specify in GA pipeline, to exclude sequences -- could someone point more details on the same? (i tried bioinformatics thread, but did not hear back )

bioinfosm is offline   Reply With Quote
Old 01-06-2009, 09:44 AM   #16
Junior Member
Location: UK

Join Date: Jan 2009
Posts: 1
Default Multiplex (12-plex) Illumina Adapter/Primer Sequences


Has anyone got the multiplex oligo sequences that Illumina use in their Multiplex (12-plex) kits? (And their concentrations if they're known.)
breakt1000 is offline   Reply With Quote
Old 01-06-2009, 10:49 AM   #17
Location: london, uk

Join Date: Jul 2008
Posts: 35

Originally Posted by bioinfosm View Post
Hi all,

Thanks for the technical details on this. Anyone got some information about bioinformatics on adapter contamination detection and removal. I tried using adapter sequences with eland to check for contamination, but less than 1% reads aligned. I expected more as less than 10% reads aligned to actual reference.

I know of a file one can specify in GA pipeline, to exclude sequences -- could someone point more details on the same? (i tried bioinformatics thread, but did not hear back )

novoalign has 5' and 3' removal of adapter sequences prior to alignment. works well.
dvh is offline   Reply With Quote
Old 01-24-2009, 10:33 AM   #18
Location: Hartford, CT

Join Date: Jan 2009
Posts: 11


I run the site you got the sequences from and am happy to see that you have posted the info here as well. I will attempt to keep the list up to date as new sequences are released. If there is any additional info you would like, let me know and I'll post it if possible.


graveley is offline   Reply With Quote
Old 01-24-2009, 11:59 AM   #19
--Site Admin--
Location: SF Bay Area, CA, USA

Join Date: Oct 2007
Posts: 1,352

Hey Brent,

Nice to have you, thanks for being willing to share with the community. I'm sure everyone would appreciate any info you have.
ECO is offline   Reply With Quote
Old 02-06-2009, 04:02 PM   #20
Junior Member
Location: California

Join Date: Aug 2008
Posts: 5
Default Adapter sequence

i know that the overhanging T is used to ligate with the added A from the DNA library, but thy is there a one base pair overhang on the other side? If you see how the sequence anneal there is an overhang on both ends. Both adapter sequences are 33 bases. If you only wanted the T overhang, why wouldn't you have 32 bases on one strand and 33 on the strand with the T overhang?
danielfortin86 is offline   Reply With Quote

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

All times are GMT -8. The time now is 06:37 AM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2017, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO