Hi everyone,
I have a problem in executing the perl script (found online) is given below, a script t0 compare 2 files
1) a file with seq IDs and its weight
2) a file with seq IDs and the sequences.
I modified the original script a bit and tried to use the code with my data,but it neither prints out the output nor gives out any errors and further I want to add the weights in the file 1 to the sequence ID after comparing and extracting the respective reads.
Input files and the script are attached.
expected output:-
>comp10003_c0_seq1 len=166 path=[748:0-22 1004:23-46 2527:47-165]_weight=41
AAGTAGCCTATGCGCTACAGTAAGAAAGACAGGTGAAAAAATGGAAGTAAAACAATTAGA
TGACTACTTTGGATATACAGAAAAGGGCAGTTCCTTAGAGGGGGAATTACGAGCAGGACT
AACGACATTCTTGACAATGGCGTACATTCTGTTTGTGAACCCAGAC
Could anyone please help me out.
Thank you in advance.
I have a problem in executing the perl script (found online) is given below, a script t0 compare 2 files
1) a file with seq IDs and its weight
2) a file with seq IDs and the sequences.
I modified the original script a bit and tried to use the code with my data,but it neither prints out the output nor gives out any errors and further I want to add the weights in the file 1 to the sequence ID after comparing and extracting the respective reads.
Input files and the script are attached.
expected output:-
>comp10003_c0_seq1 len=166 path=[748:0-22 1004:23-46 2527:47-165]_weight=41
AAGTAGCCTATGCGCTACAGTAAGAAAGACAGGTGAAAAAATGGAAGTAAAACAATTAGA
TGACTACTTTGGATATACAGAAAAGGGCAGTTCCTTAGAGGGGGAATTACGAGCAGGACT
AACGACATTCTTGACAATGGCGTACATTCTGTTTGTGAACCCAGAC
Could anyone please help me out.
Thank you in advance.
Comment