Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • empty fastq files after Miseq is done

    Dear all,
    I am new in this field and I done my first sequencing using MiSeq. I checked the files and found that all generated fastq.gz files are empty except two files with names Undetermined_****.fastq.gz are in the Data/Intensities/BaseCalls/ folder which has data (each is about 200 kb).

    Could you please help me to explain where is the problem?

    Thank you

  • #2
    Sounds like you had a demultiplexing failure. Check your sample sheet one more time (easy mistake is to provide the indexes in rev-comp) and re-queue demultiplexing. You should use Illumina Experiment Manager software (windows only) available from Illumina to make the sample sheet, if you are new to sequencing.

    At worst, your run may have failed. Best solution to check on either possibilities is to contact Illumina tech support. They should be able to take a look at your MiSeq remotely (if your MiSeq is not on network then they will ask for a few files) and diagnose.

    Comment


    • #3
      Thank you.

      I will check both possibilities. I looked at the CompletedJobInfo file and it seems to be fine. I attached also my samplesheet file. I hope you have time to check them.

      I really appreciate your efforts.
      Attached Files

      Comment


      • #4
        Originally posted by GenoMax View Post
        Sounds like you had a demultiplexing failure. Check your sample sheet one more time (easy mistake is to provide the indexes in rev-comp) and re-queue demultiplexing. You should use Illumina Experiment Manager software (windows only) available from Illumina to make the sample sheet, if you are new to sequencing.

        At worst, your run may have failed. Best solution to check on either possibilities is to contact Illumina tech support. They should be able to take a look at your MiSeq remotely (if your MiSeq is not on network then they will ask for a few files) and diagnose.
        Thank you.

        I will check both possibilities. I looked at the CompletedJobInfo file and it seems to be fine. I attached also my samplesheet file. I hope you have time to check them.

        I really appreciate your efforts.

        Comment


        • #5
          It won't be very useful to look at the Samplesheet. If MiSeq accepted it at run time then it must have been in the correct format. If your samples did not demultiplex then it is very likely that you have wrong index sequence information in your samplesheet.

          Can you post a screenshot of the Sequence Analysis Viewer info for this run? Especially the alignment to phiX. That would be useful for diagnosis.

          Comment


          • #6
            Originally posted by GenoMax View Post
            It won't be very useful to look at the Samplesheet. If MiSeq accepted it at run time then it must have been in the correct format. If your samples did not demultiplex then it is very likely that you have wrong index sequence information in your samplesheet.

            Can you post a screenshot of the Sequence Analysis Viewer info for this run? Especially the alignment to phiX. That would be useful for diagnosis.
            Unfortunately due to COVID 19 measures I have no access to the MiSeq machine now. I only have the run files. Also we did not include phiX sample control. Is there any file in the run folder can be representative so that I share it with you?

            I really appreciate your help.

            Comment


            • #7
              Are you able to use command line? If you are I can suggest some options to look at those "Undetermined" files to see what may be going on.

              If you are able to open them (on PC/Mac) post a small number of example reads here.

              Comment


              • #8
                If you look at the DemultiplexSummaryF1L1.txt it will tell you what barcodes were used on the run if the demultiplexing worked.

                It's located at
                <run folder>\Data\Intensities\BaseCalls\Alignment
                Josh Kinman

                Comment


                • #9
                  Originally posted by GenoMax View Post
                  Are you able to use command line? If you are I can suggest some options to look at those "Undetermined" files to see what may be going on.

                  If you are able to open them (on PC/Mac) post a small number of example reads here.
                  Yes I can. Here are some reads
                  @M02006:24:000000000-J397M:1:1101:17423:1618 2:N:0:0
                  CATTGTTCCTTTTGCTTCTTTCCTTTCCCTCTTCTCTTTCTTTTCTCTTCTCTCCTTCTTTTTTCTTTTTTGCCTCTCTTGTTTTCTTACTCTCTTTCCCCCTCTTTTTTCTCTTTCTTTCTTCTCCCTCTCTCTCCCTCACCTTTTCTAT
                  +
                  1111>3333B@3111A13D1331333111A0011A133333111212D212A210111111D1/011111/A1111B01A111002D12111211212110///01B11/012@21221B2212B1100000111100000/0111121B2
                  @M02006:24:000000000-J397M:1:1101:17369:2159 2:N:0:0
                  TCGCCGGCCTAGTAGGCCCTTCCCTTAGTCTCCTTCTTCTCGCTGCATTCTGACACCCCGGCTCTCTACTTGGCGCTGCTCAACTTTCTAATGTGGCCGCGCGTCGTGTAGGGCACTAGTGTCGTCCTGCGTGTCGATCTCGGAGGTCGCG
                  +
                  11111>>1100B1AG11B00A000111B22211B111D22B///B/A1222221B1///A////0112D211F0@//E/1111021FD2222B2BF/B>///>//</?/011?0//01?1?1</<//.<1>.<>0CA<..0<..--./:--
                  @M02006:24:000000000-J397M:1:1101:18125:2191 2:N:0:0
                  CCCCTTTCCCTCTGTCTTCTCCCTCGGCGCCTTCTTTGCTCTTCTCGCCGGCTTCGTTGTCCGCGCGTCGTGTCGTGCCCGCGTGTCCCGCTGGTTGTCGCTCTCTGTTGTCGCCGTCTCCTTCCCCCCCCGCCTGCCCTCCCCTTCTGTT
                  +
                  11>11111111>11B333331AA1BA0000A00111A111A1112BA/A//A//0>000B11//>////>///0///</0//////011/////01/?1/////1111<101<..-<-./00<0///<------...../....9.-////
                  @M02006:24:000000000-J397M:1:1101:21922:3716 2:N:0:0
                  GTTTTTCCTCGTCTGCCCGGCCTCCGTTCTTTCTTTCTCTTCTCCCCGTGCTGCTTCCCGCTTCTTCTCCTTTGCACCCCTCTTTCTTCCTGGTCCTCTTGGCGTGCGCCTTCTTGCCTCTTCCTCCCTGTCTCCCGTTTGTCCGCACGTG
                  +
                  1>111111311>11A1111000000BA100AA22D12BA2212110///B//1A11110/////11221111211210///?01122121@101111111110///?><///111111111111110/01<12>10//00/021/////0.
                  @M02006:24:000000000-J397M:1:1101:17741:4534 2:N:0:0
                  CTTCTCTTTTCTTTTCGGCGCTTGCTCCGGTCTCCTTGGCCCCTCCTTCCGTCTCCTGCTTCGCGCTGCCTTCGGTCGCCCCGGGCCCTTCCTTGGCGCTGGGCCGCGCGTCGTGTCGGGCCCGCGTGTCCCCGCGTGTGTCGATCTCGGT

                  Comment


                  • #10
                    Originally posted by jdk787 View Post
                    If you look at the DemultiplexSummaryF1L1.txt it will tell you what barcodes were used on the run if the demultiplexing worked.

                    It's located at
                    <run folder>\Data\Intensities\BaseCalls\Alignment
                    Yes I can see this file. None of the barcodes which I used has hit and only some hits are for different barcodes

                    Comment


                    • #11
                      @mmhefny,

                      Are you sure this run was set up to run a index cycle? This run header does not seem to make it look so.

                      Code:
                      @M02006:24:000000000-J397M:1:1101:21922:3716 2:N:0:0
                      Normally one should see something like this at the end of fastq header for index sequence

                      Code:
                      @M02006:24:000000000-J397M:1:1101:21922:3716 1:N:0:GAACGCAA+CTGGCACT
                      Can you find the RunInfo.xml file and post the section that shows this part?
                      Code:
                      <Reads>
                            <Read NumCycles="150" Number="1" IsIndexedRead="N" />
                            <Read NumCycles="8" Number="2" IsIndexedRead="Y" />
                            <Read NumCycles="8" Number="3" IsIndexedRead="Y" />
                            <Read NumCycles="150" Number="4" IsIndexedRead="N" />
                          </Reads>

                      Comment


                      • #12
                        Originally posted by GenoMax View Post
                        @mmhefny,

                        Are you sure this run was set up to run a index cycle? This run header does not seem to make it look so.

                        Code:
                        @M02006:24:000000000-J397M:1:1101:21922:3716 2:N:0:0
                        Normally one should see something like this at the end of fastq header for index sequence

                        Code:
                        @M02006:24:000000000-J397M:1:1101:21922:3716 1:N:0:GAACGCAA+CTGGCACT
                        Can you find the RunInfo.xml file and post the section that shows this part?
                        Code:
                        <Reads>
                              <Read NumCycles="150" Number="1" IsIndexedRead="N" />
                              <Read NumCycles="8" Number="2" IsIndexedRead="Y" />
                              <Read NumCycles="8" Number="3" IsIndexedRead="Y" />
                              <Read NumCycles="150" Number="4" IsIndexedRead="N" />
                            </Reads>
                        This part of RunInfo.xml is as follow
                        Code:
                            <Reads>
                              <Read NumCycles="151" Number="1" IsIndexedRead="N" />
                              <Read NumCycles="8" Number="2" IsIndexedRead="Y" />
                              <Read NumCycles="8" Number="3" IsIndexedRead="Y" />
                              <Read NumCycles="151" Number="4" IsIndexedRead="N" />
                            </Reads>
                        Last edited by GenoMax; 04-02-2020, 10:54 AM. Reason: Added [code]tags

                        Comment


                        • #13
                          Ah so your run was dual-indexed. I am puzzled as to why your reads don't have any index sequence in fastq headers.

                          What do you see in DemuxSummaryF1L1.txt?

                          Scroll down the file until your see this section:
                          Code:
                          ### Most Popular Unknown Index Sequences
                          ### Columns: Index_Sequence Hit_Count
                          CTCATCAC+GGTGGCAC       2940
                          AGGTCAAG+CGCGTAAT       860
                          TCCAGGTA+GCTTCAGT       700

                          Comment


                          • #14
                            Originally posted by GenoMax View Post
                            Ah so your run was dual-indexed. I am puzzled as to why your reads don't have any index sequence in fastq headers.

                            What do you see in DemuxSummaryF1L1.txt?

                            Scroll down the file until your see this section:
                            Code:
                            ### Most Popular Unknown Index Sequences
                            ### Columns: Index_Sequence Hit_Count
                            CTCATCAC+GGTGGCAC       2940
                            AGGTCAAG+CGCGTAAT       860
                            TCCAGGTA+GCTTCAGT       700
                            they are:

                            ### Most Popular Index Sequences
                            ### Columns: Sequence ReverseComplement HitCount
                            Index
                            C.CCC.CC GG.GGG.G 96
                            C.CCT.GC GC.AGG.G 94
                            C.CGC.CG CG.GCG.G 78
                            C.GCC.TT AA.GGC.G 65
                            C.ACC.CT AG.GGT.G 44
                            C.CCC.CT AG.GGG.G 40
                            C.ACG.GG CC.CGT.G 38
                            C.CGC.GG CC.GCG.G 37
                            C.AGC.GG CC.GCT.G 36
                            C.CGC.TC GA.GCG.G 33
                            C.CCC.CG CG.GGG.G 29

                            Comment


                            • #15
                              Originally posted by GenoMax View Post
                              Ah so your run was dual-indexed. I am puzzled as to why your reads don't have any index sequence in fastq headers.

                              What do you see in DemuxSummaryF1L1.txt?

                              Scroll down the file until your see this section:
                              Code:
                              ### Most Popular Unknown Index Sequences
                              ### Columns: Index_Sequence Hit_Count
                              CTCATCAC+GGTGGCAC       2940
                              AGGTCAAG+CGCGTAAT       860
                              TCCAGGTA+GCTTCAGT       700
                              This is the file and it does not have this Unknown Index Sequences
                              Attached Files

                              Comment

                              Latest Articles

                              Collapse

                              • seqadmin
                                Essential Discoveries and Tools in Epitranscriptomics
                                by seqadmin




                                The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
                                04-22-2024, 07:01 AM
                              • seqadmin
                                Current Approaches to Protein Sequencing
                                by seqadmin


                                Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
                                04-04-2024, 04:25 PM

                              ad_right_rmr

                              Collapse

                              News

                              Collapse

                              Topics Statistics Last Post
                              Started by seqadmin, Today, 11:49 AM
                              0 responses
                              11 views
                              0 likes
                              Last Post seqadmin  
                              Started by seqadmin, Yesterday, 08:47 AM
                              0 responses
                              16 views
                              0 likes
                              Last Post seqadmin  
                              Started by seqadmin, 04-11-2024, 12:08 PM
                              0 responses
                              61 views
                              0 likes
                              Last Post seqadmin  
                              Started by seqadmin, 04-10-2024, 10:19 PM
                              0 responses
                              60 views
                              0 likes
                              Last Post seqadmin  
                              Working...
                              X