SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Standalone BLAST results daniellaplummer Bioinformatics 2 01-15-2015 07:14 PM
Different blast results between CLCBio and local blast arundurvasula Bioinformatics 0 07-01-2014 09:17 AM
Blast Results GO Mapping milo0615 Bioinformatics 1 11-20-2013 06:43 AM
Tallying BLAST results JuliaEpps Bioinformatics 1 10-31-2013 01:57 AM
blast results nitinkumar Bioinformatics 8 05-16-2011 07:17 AM

Reply
 
Thread Tools
Old 08-08-2017, 03:00 AM   #1
Jona
Junior Member
 
Location: Italy

Join Date: Aug 2017
Posts: 1
Default BLAST possibly returning different results

Hi to everyone,
this is my very first post and first of all I'd like to thanks Seqanswers for the possibility offered.

I've submitted the following sequence to BLASTN:
CTTGACAAGCTAGCTTTAGTTTAAAAACTCCAACTGCCAAAGGAATTAAATTTTTCTTAAAGTAGTATTTCTAAAATACAATTTTTTTGAATTAGTAGTA

among the results I received also a single match to the following organism:
Clostridium botulinum Ba4 str. 657 GenBank CP001083.1

so I tried and run BLASTN again specifying the organism in the Organism field of BLASTN.

Surprisingly I did obtain 4 matches now (apart from plasmid). They are highlighted in black as poor results but why did BLASTN provide them now only?

Thanks for any help

Last edited by Jona; 08-08-2017 at 03:04 AM.
Jona is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 05:50 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2017, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO