SEQanswers

Go Back   SEQanswers > Applications Forums > RNA Sequencing



Similar Threads
Thread Thread Starter Forum Replies Last Post
Kmer Result of FastQC Report Azedenkae Bioinformatics 1 09-29-2014 11:13 PM
Kmer changes after Trimming Alex Lee RNA Sequencing 1 07-07-2014 03:29 PM
fastqc Kmer Interpretation Help ifthenelse Bioinformatics 0 01-08-2014 06:18 AM
strange FastQC kmer plot even after trimming fahmida Bioinformatics 8 08-01-2013 11:23 PM
FastQC GGGGG Kmer Potjie Bioinformatics 3 07-29-2013 02:24 AM

Reply
 
Thread Tools
Old 10-08-2014, 06:20 PM   #1
skmotay
Member
 
Location: MN

Join Date: Oct 2014
Posts: 28
Default FastQC, Kmer count, Trimmomatic: no success in trimming, still fail Kmer

I'm using RNAseq for DGE and failed in trying to map paired end reads in TopHat2. Samples passed the first two parts of fastqc, but failed per base and Kmer count. Some samples did pass per base.

I tried trimming them to remove adaptors, but nothing improved the Kmer plot. http://imgur.com/Fhbx534 All of the kmer plots from this data set (18) look similar. I used the adaptor settings built into trimmomatic, but none worked. I then emailed genewhiz and asked for their (truseq) adaptors, but trimming for those sequences didn't improve the plots.

Ex per seq quality score http://imgur.com/5L5PaJU,Hg2mHk0#0
per base http://imgur.com/5L5PaJU,Hg2mHk0#1

Am I doing something wrong? Should I just trim everything across certain bases?

Edit: reads are paired

adaptor input file:
>PrefixPE
GATCGGAAGAGCACACGTCTGAACTCCAGTCAC
>Prefix PE
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT

Last edited by skmotay; 10-09-2014 at 07:22 AM. Reason: links for images
skmotay is offline   Reply With Quote
Old 10-08-2014, 06:46 PM   #2
Brian Bushnell
Super Moderator
 
Location: Walnut Creek, CA

Join Date: Jan 2014
Posts: 2,695
Default

Are your reads paired? If so, you can trim them with BBDuk via overlap, without specifying the adapter sequence, like this:

bbduk.sh in1=r1.fq in2=r2.fq out1=trimmed1.fq out2=trimmed2.fq tpe tbo

That package comes with both TruSeq and Nextera adapters, which are another possibility that you can try.
Brian Bushnell is offline   Reply With Quote
Old 10-08-2014, 06:52 PM   #3
skmotay
Member
 
Location: MN

Join Date: Oct 2014
Posts: 28
Default

Yes, reads are paired.

I think I should have mentioned that I'm working in Galaxy, which I think limits what tools I can use. I don't see BBDuk in my tools.
skmotay is offline   Reply With Quote
Old 10-08-2014, 07:04 PM   #4
Brian Bushnell
Super Moderator
 
Location: Walnut Creek, CA

Join Date: Jan 2014
Posts: 2,695
Default

Ah, too bad. I'll see if I can get BBTools put into Galaxy. Though you can still download it and try out the Nextera adapter file. I would recommend, though, that you contact the source of the data to find out what kind of adapters were actually used - that will save a lot of time.
Brian Bushnell is offline   Reply With Quote
Old 10-08-2014, 07:31 PM   #5
skmotay
Member
 
Location: MN

Join Date: Oct 2014
Posts: 28
Default

I emailed genewhiz and they sent me the adaptor sequences (listed I original post). I'm not quite sure I wrote the adaptor sequence file correctly and I couldn't find a clear example.
skmotay is offline   Reply With Quote
Old 10-09-2014, 12:37 AM   #6
avo
Member
 
Location: Germany

Join Date: Sep 2013
Posts: 14
Default

Does Fastqc give you a warning for overrepresented sequences?

I don't know the default -k setting for fastqc but maybe it helps to increase it.
My impression is that the adapter trimming worked. But the overrepresented k-mers test fails due to other reasons
avo is offline   Reply With Quote
Old 10-09-2014, 07:24 AM   #7
skmotay
Member
 
Location: MN

Join Date: Oct 2014
Posts: 28
Default

They all pass overrepresented sequences.
skmotay is offline   Reply With Quote
Reply

Tags
adaptor trimming, fastqc, kmer, rnaseq, trimmomatic

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 04:19 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2017, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO