SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
Custom primers and PhiX on MiSeq gleb Illumina/Solexa 14 05-09-2017 08:53 AM
Spiking custom primers failed on Miseq runs katinka03 Illumina/Solexa 4 03-27-2017 06:33 AM
Using MiSeq with both standard and custom sequencing/index primers at the same time? kevin_bryant Illumina/Solexa 1 02-27-2014 12:57 PM
miseq custom primers barturas Illumina/Solexa 1 07-01-2013 05:46 AM
Nextera primers wingtec Illumina/Solexa 0 01-31-2013 12:43 PM

Reply
 
Thread Tools
Old 05-19-2017, 01:29 PM   #1
adziulko
Junior Member
 
Location: New York

Join Date: May 2017
Posts: 1
Default Nextera Miseq custom primers

Hi,

I am new to deep sequencing and would like a little help. I am trying to design custom primers to use on one end of my fragmented DNA for a Nextera Miseq. I am wondering if my primers need any modifications such as phosphorylations to be able to bind to the chip, or if I can get away with discluding the i5/i7 sequences.

I have designed two primers (to match the P7 or P5 end that would be randomly inserted due the random inserts of tagmentation). My primer design looks like this:

Primer to be paired with P5:
5' CAAGCAGAAGACGGCATACGAGATGTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGTACCCTCCTGCTTAAGGGC


Primer to be paired with P7:
5' AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTACCCTCCTGCTTAAGGGC

*Red = P7/P5 ends complementing chip oligo
*Green = transposon adaptor sequence
*3' black end = transposon sequence
*Brown = complementing region to DNA

Please let me know if you see any problems in this design and let me know if you think it will work. Thanks.
adziulko is offline   Reply With Quote
Old 05-19-2017, 08:31 PM   #2
nucacidhunter
Senior Member
 
Location: Iran

Join Date: Jan 2013
Posts: 1,035
Default

I wonder if you could indicate what you are trying to do. Primers "complementing DNA region" is the same in both so it cannot be standard custom amplicon.

You would not need any modification on primers except phosphorothioate bond in some cases where 3' end protection is important.
nucacidhunter is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 07:04 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2017, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO