SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Viral genome vs transcripts vijesh Bioinformatics 5 06-14-2013 12:20 AM
ViralFusionSeq marcowanger Literature Watch 0 01-13-2013 10:13 PM
viral genome alignment mathew Bioinformatics 8 12-03-2012 08:33 AM
annotation for viral genome honey Bioinformatics 3 10-07-2012 09:18 PM

Reply
 
Thread Tools
Old 07-16-2013, 07:28 AM   #1
eligar97
Junior Member
 
Location: Ohio

Join Date: Jul 2013
Posts: 2
Default Viral Alignment- ViralFusionSeq

Hi everyone. I am a high school intern and I am working in aligning viral genomes to RNAseq data. I am very new to bioinformatics, and am still learning how to manage alignment software. I have been using the software ViralFusionSeq to locate viral integration sites. Unfortunately, I am having major technical difficulties. I am constantly getting the same error message when I try to run the sample dataset. I have installed all of the cpan modules and 3rd party software, but I still get this error:

Thread 1 terminated abnormally: main=HASH(0x2b212422a238) at viral.fusion.pl line 621.
Thread 2 terminated abnormally: main=HASH(0x2b212822a240) at viral.fusion.pl line 622.
Use of uninitialized value $ReturnData[0] in join or string at viral.fusion.pl
line 624 (#1)
(W uninitialized) An undefined value was used as if it were already
defined. It was interpreted as a "" or a 0, but maybe it was a mistake.
To suppress this warning assign a defined value to your variables.

To help you figure out what was undefined, perl will try to tell you the
name of the variable (if any) that was undefined. In some cases it cannot
do this, so it also tells you what operation you used the undefined value
in. Note, however, that perl optimizes your program and the operation
displayed in the warning may not necessarily appear literally in your
program. For example, "that $foo" is usually optimized into "that "
. $foo, and the warning will refer to the concatenation (.) operator,
even though there is no . in your program.

Use of uninitialized value $ReturnData2[0] in join or string at viral.fusion.pl
line 627 (#1)


Does anyone who has used this software have any ideas as to why I have this error?

Thanks for your help.
eligar97 is offline   Reply With Quote
Old 07-18-2013, 01:20 AM   #2
marcowanger
Senior Member
 
Location: Hong Kong

Join Date: Dec 2008
Posts: 350
Default

Hi eligar97,

Which version fo VFS did you download?

Are you running VFS on Ubuntu system, or others?

Marco
__________________
Marco
marcowanger is offline   Reply With Quote
Old 07-18-2013, 05:06 AM   #3
eligar97
Junior Member
 
Location: Ohio

Join Date: Jul 2013
Posts: 2
Default

I'm using the December 7th, 2012 version. Its being run on Ubuntu.
eligar97 is offline   Reply With Quote
Old 07-30-2013, 08:52 AM   #4
marcowanger
Senior Member
 
Location: Hong Kong

Join Date: Dec 2008
Posts: 350
Default

Hi eli, did the single thread version of VFS works?
__________________
Marco
marcowanger is offline   Reply With Quote
Old 01-02-2014, 12:32 PM   #5
akhattri
Member
 
Location: Chicago ZIP Code 60637

Join Date: Mar 2011
Posts: 8
Default

hi there, I am also getting somewhat similar error while running VFS (VERSION: Revision 1250) on CentOS 5 release 5.10 (Final) system. After this error SSAKE also fails. Please let me know how this can be fixed. The portions of error output are below. Thanks for the help.

Code:
Command
perl 2.run.example.dataset.pl

The file "2.run.example.dataset.pl" has a the following command:
perl viral.fusion.pl --config vfs.conf --insertSIZE 350 HKCI5a CL7R_1_VFS.fq CL7R_2_VFS.fq

Both the fq files are included in vfs and I edited vfs.conf file to include the path of 3rd party software.


Error 1
Hashing CL7R_1_VFS.dynamic.min35.fq.gz
Hashing CL7R_2_VFS.dynamic.min35.fq.gz
Use of uninitialized value in concatenation (.) or string at
	/data3/users/arun/Apps/vfs/include/RPmethod.pm line 268 (#1)
    (W uninitialized) An undefined value was used as if it were already
    defined.  It was interpreted as a "" or a 0, but maybe it was a mistake.
    To suppress this warning assign a defined value to your variables.
    
    To help you figure out what was undefined, perl tells you what operation
    you used the undefined value in.  Note, however, that perl optimizes your
    program and the operation displayed in the warning may not necessarily
    appear literally in your program.  For example, "that $foo" is
    usually optimized into "that " . $foo, and the warning will refer to
    the concatenation (.) operator, even though there is no . in your
    program.
    
Hashing vfs_dev.HKCI5a.4h_map.fq
Entering Essential::tx_targeted_assembly.
Skipped Insert Size estimation. Supplied insert size: 350
Essential::ssake_reads_prep
Assuming fasta file
Hashing vfs_dev.HKCI5a.RPm.out_2.fa
Processing vfs_dev.HKCI5a.RPm.out_1.fa and vfs_dev.HKCI5a.RPm.out_2.fa
Use of uninitialized value in pattern match (m//) at
	/data3/users/arun/Apps/vfs/include/Essential.pm line 1236, <$Lfh> line 2 (#1)
Use of uninitialized value in concatenation (.) or string at
	/data3/users/arun/Apps/vfs/include/Essential.pm line 1238, <$Lfh> line 2 (#1)
Use of uninitialized value in pattern match (m//) at
	/data3/users/arun/Apps/vfs/include/Essential.pm line 1236, <$Lfh> line 4 (#1)
Use of uninitialized value in concatenation (.) or string at
	/data3/users/arun/Apps/vfs/include/Essential.pm line 1238, <$Lfh> line 4 (#1)
 

 --------------continued to even no of lines (6,8,10,12,14...36)--------------

	/data3/users/arun/Apps/vfs/include/Essential.pm line 1236, <$Lfh> line 38 (#1)
Use of uninitialized value in concatenation (.) or string at
	/data3/users/arun/Apps/vfs/include/Essential.pm line 1238, <$Lfh> line 38 (#1)



Error 2: SSAKE

Running: /data3/users/arun/Apps/ssake_v3-8/SSAKE [v3.8]
-f vfs_dev.HKCI5a.RPm.plus.vicinity.CS_FnR.ssake.in
-s vfs_dev.HKCI5a.CSm.out.fullread.fa
	-i 0
-h 0
-w 1
-m 20
-o 3
-r 0.9
-t 0
-z 100
-p 1
-e 0.75
-k 4
-a 0.5
-x 20
Unpaired reads (optional) -g no-g
Scaffolds: vfs_dev.HKCI5a.targeted.assembly.sensitive.scaffolds
Merged contigs: vfs_dev.HKCI5a.targeted.assembly.sensitive.mergedcontigs
Pairing issues: vfs_dev.HKCI5a.targeted.assembly.sensitive.pairing_issues
Pairing distance distribution: vfs_dev.HKCI5a.targeted.assembly.sensitive.pairing_distribution.csv

Contigs: vfs_dev.HKCI5a.targeted.assembly.sensitive.contigs
Singlets: vfs_dev.HKCI5a.targeted.assembly.sensitive.singlets

Excluded reads: vfs_dev.HKCI5a.targeted.assembly.sensitive.short
Log: vfs_dev.HKCI5a.targeted.assembly.sensitive.log

=>Reading sequences initiated Thu Jan  2 14:45:44 CST 2014
Sequence reads loaded:
616Input error at line #618: The sequence "0:" is not in the right format for paired-end reads  -- Fatal
Make sure your input is in the form (input sequences can be of variable lengths):

>test
GCTACGACTATGACATACAGT:GTAGATTGATCGCATGCACGCT

Where : separates paired reads.  Spaces, <<.>> or any characters other than A,C,G or T in your input file might have caused this error, including reads with Ns.
mv: cannot stat `vfs_dev.HKCI5a_temp/*.targeted.*.contigs': No such file or directory
Number of log files deleted:  0

Last edited by akhattri; 01-03-2014 at 04:18 PM. Reason: included the command used to run the vfs
akhattri is offline   Reply With Quote
Old 01-03-2014, 02:51 PM   #6
swbarnes2
Senior Member
 
Location: San Diego

Join Date: May 2008
Posts: 912
Default

Why don't you start by including a snippet from your input files, and the exact command line you used.
swbarnes2 is offline   Reply With Quote
Old 01-03-2014, 03:06 PM   #7
akhattri
Member
 
Location: Chicago ZIP Code 60637

Join Date: Mar 2011
Posts: 8
Default

hi there, As swbarnes2 said, I've included the command ,in my question above , that I used to run vfs.
I used the same test files provided with the software (vfs), hence, I've not included the snippets.

Let me know if you need any other information.

Thanks
akhattri is offline   Reply With Quote
Old 01-05-2014, 07:11 PM   #8
marcowanger
Senior Member
 
Location: Hong Kong

Join Date: Dec 2008
Posts: 350
Default

akhattri, I am looking at your problem now.

Quote:
Originally Posted by akhattri View Post
hi there, As swbarnes2 said, I've included the command ,in my question above , that I used to run vfs.
I used the same test files provided with the software (vfs), hence, I've not included the snippets.

Let me know if you need any other information.

Thanks
__________________
Marco
marcowanger is offline   Reply With Quote
Old 01-16-2014, 07:09 AM   #9
IBseq
Member
 
Location: uk

Join Date: Jul 2012
Posts: 56
Default

hi everyone,
hope I'm in the right place!

I need to use vfs to detect fusions in my sequenced samples.

I am a very beginner on unix, thus im havng problems to get started:
I have downloaded vfs version 1289
I have downloaded all third party programs and hopefully everything i need to run it...

but!
I seem i might have missed the perl script to run the program...

any help?

thanks,
ib
IBseq is offline   Reply With Quote
Old 01-16-2014, 05:14 PM   #10
marcowanger
Senior Member
 
Location: Hong Kong

Join Date: Dec 2008
Posts: 350
Default

Dear IBseq,

First you need to run 1.VFS.sys.check.pl to see if the dependencies can be called successfully. If you have already done that, then it is nice.

Then you either run viral.fusion.pl with your config file, or "2.run.example.dataset.pl" to test VFS on the example data supplied with the package.

Hope it helps.

Marco
__________________
Marco
marcowanger is offline   Reply With Quote
Old 01-16-2014, 11:16 PM   #11
IBseq
Member
 
Location: uk

Join Date: Jul 2012
Posts: 56
Default

Quote:
Originally Posted by marcowanger View Post
Dear IBseq,

First you need to run 1.VFS.sys.check.pl to see if the dependencies can be called successfully. If you have already done that, then it is nice.

Then you either run viral.fusion.pl with your config file, or "2.run.example.dataset.pl" to test VFS on the example data supplied with the package.

Hope it helps.

Marco

Thanks Marco,
I have run 1.VFS.sys.check.pl but where can I see the output?
No error came up, so shall I assume everything is correctly installed with correct dependencies?

Thanks very much,
ib
IBseq is offline   Reply With Quote
Old 01-21-2014, 02:31 AM   #12
IBseq
Member
 
Location: uk

Join Date: Jul 2012
Posts: 56
Default

Hello everyone,
quick question about vfs: to save my viral genome of interest, is is enough to use the fasta file from NCBI website (http://www.ncbi.nlm.nih.gov/nuccore/...9?report=fasta) and replace it with the hbv4.fa? i have noticed that the viral genome that comes with the package is different..

any suggestion?
thanks,
ib
IBseq is offline   Reply With Quote
Old 01-21-2014, 02:32 AM   #13
IBseq
Member
 
Location: uk

Join Date: Jul 2012
Posts: 56
Default

I meant different as it contains different lines. Not sure if this is specific with the hbv4 genome (which i dont know much about!)
IBseq is offline   Reply With Quote
Old 01-22-2014, 12:02 AM   #14
IBseq
Member
 
Location: uk

Join Date: Jul 2012
Posts: 56
Default vfs running

hi everyone
(if anyone is there!!!)

I run the vfs example 1.VFS.sys.check.pl and got nothing. this is the report after i submitted the job:

Make sure BWA is installed and is available in PATH
List::Util qw( min max ) loaded: OK
Bio:B::Sam loaded: OK
Bio::SeqIO loaded: OK
Bio::SearchIO loaded: OK
Bio:B::Sam loaded: OK
AppConfig fails loading.
AppConfig::Getopt fails loading.
Cwd loaded: OK
Exporter loaded: OK
File::Which fails loading.
FileHandle loaded: OK
FindBin loaded: OK
Pod::Usage loaded: OK
Statistics:escriptive loaded: OK
File::Copy loaded: OK
PerlIO::gzip fails loading.
Please check AppConfig is installed properly
Please check AppConfig::Getopt is installed properly
Please check File::Which is installed properly
Please check PerlIO::gzip is installed properly


please any help!!!!

thanks,
ib
IBseq is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 06:45 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO