SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
rsem-calculate-expression takes very long with paired-end reads (using bowtie2) roschu RNA Sequencing 0 07-28-2014 04:18 AM
Using Bowtie2 for to align paired end reads sewellh Bioinformatics 5 06-05-2014 10:50 AM
Bowtie2 mapping and paired-end reads westeros Bioinformatics 3 03-22-2014 01:02 AM
Bowtie2 output fastq of paired reads where at least one in the pair aligns shawn.mek Bioinformatics 0 09-06-2013 11:24 AM
Bowtie output from paired end reads godzilla07 Bioinformatics 0 01-06-2011 11:36 AM

Reply
 
Thread Tools
Old 08-14-2014, 06:07 AM   #1
sampie
Member
 
Location: Finland

Join Date: Jun 2014
Posts: 10
Default Bowtie2 output with paired end reads

Hi,

I am trying to use bowtie2 to align paired end Illumina read files.

I am using following command:

./bowtie2 -a --threads 8 --n-ceil 42 --very-sensitive-local --quiet --no-sq --no-hd --np 0 --ma 1 --mp 0,0 --rdg 1,1 --rfg 1,1 --score-min L,0,0.95 -x rdp/bt2_index/rdp.db -q -1 sR1.fastq -2 sR2.fastq > bt2out.txt

The index is made from RDP II database and currently sR1.fastq and sR2.fastq contain only one read:

sR1.fastq:
@1_M01363:14:000000000-A5K8J:1:1101:8617:1211 1:N:0:16
TACGGAGGATCCGAGCGTTATCCGGA...

sR2.fastq:
@2_M01363:14:000000000-A5K8J:1:1101:8617:1211 2:N:0:16
TTCACCGTTGCCGGCGTACTCCCCAGGTGGA

The bt2out.txt file shows mostly results with sR1.fastq read header.

1_M01363:14:000000000-A5K8J:1:1101:8617:1211....
1_M01363:14:000000000-A5K8J:1:1101:8617:1211....
1_M01363:14:000000000-A5K8J:1:1101:8617:1211....
.
.
.

I am not sure how to read bowtie2 results. How can I obtain information how each matching read aligned as a pair?

Thanks
sampie is offline   Reply With Quote
Old 08-14-2014, 08:09 AM   #2
westerman
Rick Westerman
 
Location: Purdue University, Indiana, USA

Join Date: Jun 2008
Posts: 1,104
Default

Bowtie2 should be outputting BAM/SAM files. Read up on that format. If you have further questions after reading about SAM files -- especially the bitwise flag field -- then ask a question.
westerman is offline   Reply With Quote
Old 08-14-2014, 08:24 AM   #3
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,978
Default

It appears that sampie omitted "-S filename_to_hold_alignments.sam" option on the command line to write the alignments to a file.
GenoMax is offline   Reply With Quote
Old 08-14-2014, 08:29 AM   #4
westerman
Rick Westerman
 
Location: Purdue University, Indiana, USA

Join Date: Jun 2008
Posts: 1,104
Default

Quote:
Originally Posted by GenoMax View Post
It appears that sampie omitted "-S filename_to_hold_alignments.sam" option on the command line to write the alignments to a file.
While good practice the '-S' is optional. As per the docs:

Quote:

-S <hit>
File to write SAM alignments to. By default, alignments are written to the "standard out" or "stdout" filehandle (i.e. the console).
So the stdout file of bt2out.txt should be a SAM file.
westerman is offline   Reply With Quote
Old 08-14-2014, 09:27 AM   #5
jwfoley
Senior Member
 
Location: Stanford

Join Date: Jun 2009
Posts: 179
Default

As long as we're talking best practices, I would definitely pipe the output through samtools and save a BAM rather than a SAM file. There's no reason a SAM file should ever exist on a hard drive.
jwfoley is offline   Reply With Quote
Old 08-15-2014, 05:35 AM   #6
sampie
Member
 
Location: Finland

Join Date: Jun 2014
Posts: 10
Default

Thanks for replies.

I took a look at SAM format specification. It was more clear to me than bowtie2 manual.

I am now testing bits 0x1, 0x2 and 0x8 from flags and if they are on I am determining that current match is R2 and previous match is R1 (of the same pair).

Hopefully it works correctly now.
sampie is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:18 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO