SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
cuffmerge crashes when converting gtf files to sam files swbiggs4 Bioinformatics 20 02-16-2017 09:19 AM
merging 2 sam files papori Bioinformatics 0 07-29-2011 04:44 AM
Editing SAM files gracezheng Bioinformatics 3 06-27-2011 08:30 AM
editing sam files gracezheng RNA Sequencing 0 06-26-2011 10:00 PM
Manipulating .sam files anunn Bioinformatics 3 03-23-2011 09:23 AM

Reply
 
Thread Tools
Old 08-19-2010, 11:12 AM   #1
frankyue50
Member
 
Location: CA

Join Date: Nov 2008
Posts: 34
Default help with sam files

Can someone help me with this rna-seq file:

SOLEXA1_0001:1:90:12539:8935#0 16 chr1 3003182 3 8M1708N28M * 0 0 CCCCCATACCCACCCCCCAATCCCCTACCCACCCAC BCCCCB>6@@@<CCCCCCCB>AAAA=0BCC=CCCBC NM:i:2 XS:A:- NS:i:2

What does NS mean? I couldn't find it in sam document. Thanks.
frankyue50 is offline   Reply With Quote
Old 08-19-2010, 12:06 PM   #2
mrawlins
Member
 
Location: Retirement - Not working with bioinformatics anymore.

Join Date: Apr 2010
Posts: 63
Default

NS is a tag specific to the program you're using to generate your SAM file. I can only guess what it means but it may be in the documentation of the program that generated the file.

NM is a standard tag that's an abbreviation of Number Mismatched(or Nucleotides Mismatched). In a similar vein, NS may be Number Substituted, in which case it differs from NM by insertion/deletion of individual nucleotides.
Because NS is not in the standard, any program that reads this SAM file can interpret it in any way. Most will simply ignore it.
mrawlins is offline   Reply With Quote
Old 08-19-2010, 12:16 PM   #3
frankyue50
Member
 
Location: CA

Join Date: Nov 2008
Posts: 34
Default

Thanks. The rna-seq data was processed by tophat. I think the line in my example is a junction. what do you guys think?

Quote:
Originally Posted by mrawlins View Post
NS is a tag specific to the program you're using to generate your SAM file. I can only guess what it means but it may be in the documentation of the program that generated the file.

NM is a standard tag that's an abbreviation of Number Mismatched(or Nucleotides Mismatched). In a similar vein, NS may be Number Substituted, in which case it differs from NM by insertion/deletion of individual nucleotides.
Because NS is not in the standard, any program that reads this SAM file can interpret it in any way. Most will simply ignore it.
frankyue50 is offline   Reply With Quote
Old 08-19-2010, 12:20 PM   #4
john_mu
Member
 
Location: Stanford, CA

Join Date: May 2010
Posts: 88
Default

EDIT: has been answered
__________________
SpliceMap: De novo detection of splice junctions from RNA-seq
Download SpliceMap Comment here
john_mu is offline   Reply With Quote
Old 08-19-2010, 12:20 PM   #5
mrawlins
Member
 
Location: Retirement - Not working with bioinformatics anymore.

Join Date: Apr 2010
Posts: 63
Default

Ah, well, if it's tophat it's pretty easy to look it up in the code.
Quote:
Mismatches within min_anchor_len of a splice junction
(from bwt_map.cpp:813 and bwt_map.h:233 in tophat source)

It's mismatches within the anchor of a splice junction. NM covers the entire read, while NS will cover only the anchor.

Last edited by mrawlins; 08-19-2010 at 12:21 PM. Reason: Added code reference
mrawlins is offline   Reply With Quote
Old 08-19-2010, 12:41 PM   #6
frankyue50
Member
 
Location: CA

Join Date: Nov 2008
Posts: 34
Default

Hi, mrawlins, you are the best! Thanks!

Quote:
Originally Posted by mrawlins View Post
Ah, well, if it's tophat it's pretty easy to look it up in the code.

(from bwt_map.cpp:813 and bwt_map.h:233 in tophat source)

It's mismatches within the anchor of a splice junction. NM covers the entire read, while NS will cover only the anchor.
frankyue50 is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 06:59 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO