Hello, every one.
I tried searching the solution to my question. But I couldn't . So put a new thread here. What I want to do is to pick out all the reads by Illumina Hiseq that contain the sequence "CACAGCTTCTAGTGCTATTCTGCGCCGGTATCC" and collect these reads into a fasta file or any other formats.
I have read through the manual of bowtie and BWA, I didn't find this usage.
Anyone could help me out?
Thanks!
I tried searching the solution to my question. But I couldn't . So put a new thread here. What I want to do is to pick out all the reads by Illumina Hiseq that contain the sequence "CACAGCTTCTAGTGCTATTCTGCGCCGGTATCC" and collect these reads into a fasta file or any other formats.
I have read through the manual of bowtie and BWA, I didn't find this usage.
Anyone could help me out?
Thanks!
Comment