SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
problems with installing Pindel Robby Bioinformatics 4 02-07-2015 08:28 PM
Pindel problem CNVboy Bioinformatics 1 03-06-2012 12:33 PM
Pindel optimization with Convey FreeKDB Bioinformatics 0 11-28-2011 03:52 AM
interpreting cuffdiff output with and without replicates pageskipro Bioinformatics 3 11-19-2011 12:25 AM
Interpreting Genomica Module Networks output AbrahamB Bioinformatics 0 02-16-2011 11:11 AM

Reply
 
Thread Tools
Old 03-01-2012, 10:36 AM   #1
bwubb
Member
 
Location: Philadelphia

Join Date: Jan 2012
Posts: 58
Default Interpreting Pindel output

Hello,

Im using Pindel to detect SV's. For the most part I understand the output I am given, but there are a few types I do not. First, Im curious why Im getting some Deletions in my Inversions file, but that is no big deal.

This is a called Inversion
Code:
####################################################################################################
3	INV 218	NT 0:0 "":""	ChrID 5	BP 131938052	131938271	BP_range 131938052	131938271	Supports 5	3	+ 1	1	- 4	2	S1 10	SUM_MS 145	1	NumSupSamples 1	1	3498_l5 1 1 4 2
TAAGTTTATAATAAGACTCCTATTAGAGACCAGTTTAATTTATTCTACTGCTTTGTCATACTAATTCAATATAATTTTAAATAAGAATTTGGAATATTTCaaaataaaaattttttaaattacaggaaaaaaaggaaggaagccagccactaagtgaaatgctacatgggtttaaggtacaaaatgtcaacccattttac
                                                                                   AGAATTTGGAATATTTCAAAATAAAAATTTTTTAAATTACAGGAAAAAAAGGAAGGAAGCCAGCCACTAAGTGAAATGCTACATGGGTTTAAGGTACAAA	+	131938035	29	3498_l5	@HWI-ST628:225:C02ATACXX:5:1203:12456:188553/2
----------------------------------------------------------------------------------------------------
ctaatgaattaccacctccatggcaggtactgacaactatttttgctgatgcctctgaaacaataatatgtatttaatcttttaaaaaaaatttacttcaGAAATAATGTTAGGATTACAGAAAAATTATAAAAATAATACAAATTATTCATATATATCCCTCATCCAGCTCCTCCTGATGTTAACAATTTATGTACTCT
                               GACAACTATTTTTGCTGATGCCTCTGAAACAATAATATGTATTTAATCTTTTAAAAAAAATTTACTTCAGAAATAATGTTAGGATTACAGAAAAATTATA	-	131938301	29	3498_l5	@HWI-ST628:225:C02ATACXX:5:2301:14130:106182/2
                     GGCAGGTACTGACAACTATTTTTGCTGATGCCTCTGAAACAATAATATGTATTTAATCTTTTAAAAAAAATTTACTTCAGAAATAATGTTAGGATTACAG	-	131938291	29	3498_l5	@HWI-ST628:225:C02ATACXX:5:2305:4222:116460/2
                     GGCAGGTACTGACAACTATTTTTGCTGATGCCTCTGAAACAATAATATGTATTTAATCTTTTAAAAAAAATTTACTTCAGAAATAATGTTAGGATTACAG	-	131938291	29	3498_l5	@HWI-ST628:225:C02ATACXX:5:2104:12836:15953/2
                     GGCAGGTACTGACAACTATTTTTGCTGATGCCTCTGAAACAATAATATGTATTTAATCTTTTAAAAAAAATTTACTTCAGAAATAATGTTAGGATTACAG	-	131938291	29	3498_l5	@HWI-ST628:225:C02ATACXX:5:1206:4455:120825/2
Is this trying to say that the 218 nucleotides between Chr5:131938052-131938271 are inverted? I guess the way the read mapping is displayed I dont see it; I dont get a sense of orientation. Assuming this INV is real and the inverted sequence is represented by the lowercase letters I should, in theory, be able to look up the ref sequence at that position and see the lowercase sequence displayed in reverse order?


The other confusing output is the Large insertion:
Code:
########################################################
12	LI	ChrID 8	90973932	4	90973925	3
TTCAAGGTGAGGAAGTGTGGGAACTATAAAAAATATGGCACACATATTCTGTAGAGAAACTATGTAAAAAAGGCGAGGTCGGGAGGAGGAAGGCTGCAGCtaaactactgaggactcagaagtctagacaaagggcttggagatttattctgtggataataagagctagttaaaatttttgagaaaagagaaggtaattg
                                                                                            GCTGCAGCCTTCCTCCTCCCGACCTCGCCTTTTTTACATAGTTTTTCTACAGAATATGTGTGCCATATTTTTTATAGTTCCCACACTTCCTCACCTTGAA
                                                                                            GCTGCAGCCTTCCTCCTCCCGACCTCGCCTTTTTTACATAGTTTCTCTACAGAATATGTGTGCCTTATTTTTTATAGTTCCCACACTTCCTCACCTTGAA
                                                                                            GCTGCAGCCTTCCTCCTCCCGACCTCGCCTTTTTTACATAGTTTCTCTACAGAATATGTGTGCCCTATTTTTTATAGTTCCCACACTTCCTCACCTTGAA
                           GAACTATAAAAACTATGGCACACATATTCTGTAGAGAAACTATGTAAAAAAGACGAGGTCTGGAGGAGGAAGGGTGCAGCTGAACTACTGAGGTCTCATA
--------------------------------------------------------
acatgatgttcaaggtgaggaagtgtgggaactataaaaaatatggcacacatattctgtagagaaactatgtaaaaaaggcgaggtcgggaggaggaagGCTGCAGCTAAACTACTGAGGACTCAGAAGTCTAGACAAAGGGCTTGGAGATTTATTCTGTGGATAATAAGAGCTAGTTAAAATTTTTGAGAAAAGAGAA
        TTGTCTTTTATCAAAATCTTTAACTAGCTTTTATTATCCACAGAATAAATCTCAAAGCCCTTTGTCTAGTCTTCTGAGTCCTCAGTAGTTTAGCTGCAGC
        TTCTCTTTTCTCAAAAATTTTAACTAGCTCTTATTGTCCACAGAATAAATTTCCAAGCCCTTTGTCTAGACTTCTGAGTCCTCAGTAGTTTAGCTGCAGC
        TTCTCTTTTCTCAAAAATTTTGACTAGCTCTTATTATCCACAGAATAAATTTCCAAGCCCTTTGTCTAGACTTCTGAGTCCTCAGTAGTTTAGCTGCAGC

Based off of the BP location given, this insertion is only 7nt? That does not seem large. There does not seem to be any other indication of the insert size or sequence. The alignments displayed just looks like poor mapping. Maybe I should just ignore this file altogether.

Does anyone know what to make of these? Thanks.
bwubb is offline   Reply With Quote
Old 03-02-2012, 07:17 AM   #2
KaiYe
Senior Member
 
Location: amsterdam

Join Date: Jun 2009
Posts: 133
Default

Quote:
Originally Posted by bwubb View Post
Hello,

Im using Pindel to detect SV's. For the most part I understand the output I am given, but there are a few types I do not. First, Im curious why Im getting some Deletions in my Inversions file, but that is no big deal.

This is a called Inversion
Code:
####################################################################################################
3	INV 218	NT 0:0 "":""	ChrID 5	BP 131938052	131938271	BP_range 131938052	131938271	Supports 5	3	+ 1	1	- 4	2	S1 10	SUM_MS 145	1	NumSupSamples 1	1	3498_l5 1 1 4 2
TAAGTTTATAATAAGACTCCTATTAGAGACCAGTTTAATTTATTCTACTGCTTTGTCATACTAATTCAATATAATTTTAAATAAGAATTTGGAATATTTCaaaataaaaattttttaaattacaggaaaaaaaggaaggaagccagccactaagtgaaatgctacatgggtttaaggtacaaaatgtcaacccattttac
                                                                                   AGAATTTGGAATATTTCAAAATAAAAATTTTTTAAATTACAGGAAAAAAAGGAAGGAAGCCAGCCACTAAGTGAAATGCTACATGGGTTTAAGGTACAAA	+	131938035	29	3498_l5	@HWI-ST628:225:C02ATACXX:5:1203:12456:188553/2
----------------------------------------------------------------------------------------------------
ctaatgaattaccacctccatggcaggtactgacaactatttttgctgatgcctctgaaacaataatatgtatttaatcttttaaaaaaaatttacttcaGAAATAATGTTAGGATTACAGAAAAATTATAAAAATAATACAAATTATTCATATATATCCCTCATCCAGCTCCTCCTGATGTTAACAATTTATGTACTCT
                               GACAACTATTTTTGCTGATGCCTCTGAAACAATAATATGTATTTAATCTTTTAAAAAAAATTTACTTCAGAAATAATGTTAGGATTACAGAAAAATTATA	-	131938301	29	3498_l5	@HWI-ST628:225:C02ATACXX:5:2301:14130:106182/2
                     GGCAGGTACTGACAACTATTTTTGCTGATGCCTCTGAAACAATAATATGTATTTAATCTTTTAAAAAAAATTTACTTCAGAAATAATGTTAGGATTACAG	-	131938291	29	3498_l5	@HWI-ST628:225:C02ATACXX:5:2305:4222:116460/2
                     GGCAGGTACTGACAACTATTTTTGCTGATGCCTCTGAAACAATAATATGTATTTAATCTTTTAAAAAAAATTTACTTCAGAAATAATGTTAGGATTACAG	-	131938291	29	3498_l5	@HWI-ST628:225:C02ATACXX:5:2104:12836:15953/2
                     GGCAGGTACTGACAACTATTTTTGCTGATGCCTCTGAAACAATAATATGTATTTAATCTTTTAAAAAAAATTTACTTCAGAAATAATGTTAGGATTACAG	-	131938291	29	3498_l5	@HWI-ST628:225:C02ATACXX:5:1206:4455:120825/2
Is this trying to say that the 218 nucleotides between Chr5:131938052-131938271 are inverted? I guess the way the read mapping is displayed I dont see it; I dont get a sense of orientation. Assuming this INV is real and the inverted sequence is represented by the lowercase letters I should, in theory, be able to look up the ref sequence at that position and see the lowercase sequence displayed in reverse order?


The other confusing output is the Large insertion:
Code:
########################################################
12	LI	ChrID 8	90973932	4	90973925	3
TTCAAGGTGAGGAAGTGTGGGAACTATAAAAAATATGGCACACATATTCTGTAGAGAAACTATGTAAAAAAGGCGAGGTCGGGAGGAGGAAGGCTGCAGCtaaactactgaggactcagaagtctagacaaagggcttggagatttattctgtggataataagagctagttaaaatttttgagaaaagagaaggtaattg
                                                                                            GCTGCAGCCTTCCTCCTCCCGACCTCGCCTTTTTTACATAGTTTTTCTACAGAATATGTGTGCCATATTTTTTATAGTTCCCACACTTCCTCACCTTGAA
                                                                                            GCTGCAGCCTTCCTCCTCCCGACCTCGCCTTTTTTACATAGTTTCTCTACAGAATATGTGTGCCTTATTTTTTATAGTTCCCACACTTCCTCACCTTGAA
                                                                                            GCTGCAGCCTTCCTCCTCCCGACCTCGCCTTTTTTACATAGTTTCTCTACAGAATATGTGTGCCCTATTTTTTATAGTTCCCACACTTCCTCACCTTGAA
                           GAACTATAAAAACTATGGCACACATATTCTGTAGAGAAACTATGTAAAAAAGACGAGGTCTGGAGGAGGAAGGGTGCAGCTGAACTACTGAGGTCTCATA
--------------------------------------------------------
acatgatgttcaaggtgaggaagtgtgggaactataaaaaatatggcacacatattctgtagagaaactatgtaaaaaaggcgaggtcgggaggaggaagGCTGCAGCTAAACTACTGAGGACTCAGAAGTCTAGACAAAGGGCTTGGAGATTTATTCTGTGGATAATAAGAGCTAGTTAAAATTTTTGAGAAAAGAGAA
        TTGTCTTTTATCAAAATCTTTAACTAGCTTTTATTATCCACAGAATAAATCTCAAAGCCCTTTGTCTAGTCTTCTGAGTCCTCAGTAGTTTAGCTGCAGC
        TTCTCTTTTCTCAAAAATTTTAACTAGCTCTTATTGTCCACAGAATAAATTTCCAAGCCCTTTGTCTAGACTTCTGAGTCCTCAGTAGTTTAGCTGCAGC
        TTCTCTTTTCTCAAAAATTTTGACTAGCTCTTATTATCCACAGAATAAATTTCCAAGCCCTTTGTCTAGACTTCTGAGTCCTCAGTAGTTTAGCTGCAGC

Based off of the BP location given, this insertion is only 7nt? That does not seem large. There does not seem to be any other indication of the insert size or sequence. The alignments displayed just looks like poor mapping. Maybe I should just ignore this file altogether.

Does anyone know what to make of these? Thanks.
thanks for the questions. We need to update Pindel wiki to explain our output format. Here are the answers to your questions:

1. Deletions in inversion output
We are able to find deletions with non-template insertions and in some cases, the length of inserted sequence is equal to the deleted one and they are reverse complementary, we put it to inversion. However we forgot to substitute type information from D to INV.

2. For inversion, the lower case is the inverted sequence of the reference. And the reads are displayed as they are in fastq file. As there are two breakpoints from one inversion, we display how reads aligned to the breakpoints in the altered reference.

3. For LI, long insertion, Pindel can find the breakpoints but cannot report the complete inserted sequence. The coordinate of the left breakpoint may be smaller than right due to target site duplication.

Kai
KaiYe is offline   Reply With Quote
Old 03-05-2012, 05:55 PM   #3
bwubb
Member
 
Location: Philadelphia

Join Date: Jan 2012
Posts: 58
Default

Thank you for the reply. It helped me to better annotate my SV information.

I noticed the LI output does not have any information about which sample the read belongs to, such as the BP file.

Is that intentional or is there a way to include that info?

Thanks.
bwubb is offline   Reply With Quote
Old 03-05-2012, 10:29 PM   #4
KaiYe
Senior Member
 
Location: amsterdam

Join Date: Jun 2009
Posts: 133
Default

Quote:
Originally Posted by bwubb View Post
Thank you for the reply. It helped me to better annotate my SV information.

I noticed the LI output does not have any information about which sample the read belongs to, such as the BP file.

Is that intentional or is there a way to include that info?

Thanks.
The LI and BP modules were added latest and still being modified. It is hard to make the summary line consistent as the other types of variants due to their properties. But we can certainly report the sample information.

Kai
KaiYe is offline   Reply With Quote
Old 03-15-2012, 07:15 AM   #5
bwubb
Member
 
Location: Philadelphia

Join Date: Jan 2012
Posts: 58
Default

Is there any general criteria or cutoffs for assessing the results? I figure as a rule the more reads mapped to a particular SV the better, but Im unclear if there is a recommended minimum number of unique reads. Maybe a SUM_MS cut-off as well?

Thank you.
bwubb is offline   Reply With Quote
Old 03-21-2012, 02:37 AM   #6
KaiYe
Senior Member
 
Location: amsterdam

Join Date: Jun 2009
Posts: 133
Default

Quote:
Originally Posted by bwubb View Post
Is there any general criteria or cutoffs for assessing the results? I figure as a rule the more reads mapped to a particular SV the better, but Im unclear if there is a recommended minimum number of unique reads. Maybe a SUM_MS cut-off as well?

Thank you.
Indeed the more supporting reads the more confident calls. SUM_MS is also a good score and the number of samples is an indication of frequency. You may wish to check the average coverage of your data and adjust cutoff accordingly.
KaiYe is offline   Reply With Quote
Old 06-08-2012, 04:38 AM   #7
xc611
Junior Member
 
Location: us

Join Date: Mar 2011
Posts: 2
Default

Hi, KaiYe:

"3. For LI, long insertion, Pindel can find the breakpoints but cannot report the complete inserted sequence. "

is there anyway to find the inserted sequence? Thanks.

Jack
xc611 is offline   Reply With Quote
Old 06-08-2012, 05:47 AM   #8
KaiYe
Senior Member
 
Location: amsterdam

Join Date: Jun 2009
Posts: 133
Default

Quote:
Originally Posted by xc611 View Post
Hi, KaiYe:

"3. For LI, long insertion, Pindel can find the breakpoints but cannot report the complete inserted sequence. "

is there anyway to find the inserted sequence? Thanks.

Jack
you may try the new assembly module in Pindel, -z option. It is able to provide inserted sequenced longer than the read length but we haven't push it to longer than 2 x read length.
KaiYe is offline   Reply With Quote
Old 01-15-2014, 09:14 PM   #9
binlangman
Member
 
Location: China

Join Date: Dec 2013
Posts: 11
Default interpreting Pindel output correctly

I used Pindel to detect CNV, I got the following files:
pindelresult_BP
pindelresult_D
pindelresult_INT_final
pindelresult_LI
pindelresult_SI
pindelresult_CloseEndMapped
pindelresult_INT
pindelresult_INV
pindelresult_RP pindelresult_TD
I wanted to know why the files: pindelresult_BP, pindelresult_CloseEndMapped, and pindelresult_LI were empty.
And how should I understand the files correctly: pindelresult_INT_final, pindelresult_INT, pindelresult_INV, pindelresult_RP, pindelresult_TD?
In the file pindelresult_TD and the file pindelresult_INV, is there any difference between upper case and lower case?
Thanks!
binlangman is offline   Reply With Quote
Old 04-29-2014, 07:25 AM   #10
KaiYe
Senior Member
 
Location: amsterdam

Join Date: Jun 2009
Posts: 133
Default

Quote:
Originally Posted by binlangman View Post
I used Pindel to detect CNV, I got the following files:
pindelresult_BP
pindelresult_D
pindelresult_INT_final
pindelresult_LI
pindelresult_SI
pindelresult_CloseEndMapped
pindelresult_INT
pindelresult_INV
pindelresult_RP pindelresult_TD
I wanted to know why the files: pindelresult_BP, pindelresult_CloseEndMapped, and pindelresult_LI were empty.
And how should I understand the files correctly: pindelresult_INT_final, pindelresult_INT, pindelresult_INV, pindelresult_RP, pindelresult_TD?
In the file pindelresult_TD and the file pindelresult_INV, is there any difference between upper case and lower case?
Thanks!
upper and lower case define junction
KaiYe is offline   Reply With Quote
Old 07-06-2014, 12:54 AM   #11
Robby
Member
 
Location: Germany

Join Date: Mar 2011
Posts: 68
Default

Hello,
I have a problem to understand the Pindel output for deletions, if the deletion is not 'pure'. For example:

PHP Code:
279     D 24    NT 16 "GAAGAGAAGAGACAAG"        ChrID chr5      BP 145645795    145645820       BP_range 145645795      145645820       Supports 14     10      13    9       1     1       S1 28   SUM_MS 406      1       NumSupSamples 1 1       C0443 13 9 1 1
GAGCTTTGGGCCCAGGAATTCCCTGTTTCTTAAAAAGTCCTTGTGTAAGGGTTCCATATCTATAAGGGAAACGGAAACACTTGCATCCACACACACACACA                CATCATCAAAAACTGAAACAAATCAACAACTGGGCTCCCTCCTTGCCCATTTCCCAGAGAGCTTTGTGAATAGTGAATTTGCATGTTAGCCAATTGCTGCT
                                                       ATATCTATAAGGGAAACAGAAACACTTGCATCCACACACACACACAGAAGAGAAGAGACAAGCATCATCAAAAACTGAAACAAATCAACAACTG           
-       145646019       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:1315:2169:66627/1
                                                                     AACAGAAACACTTGCATCCACACACACACACAGAAGAGAAGAGACAAGCATCATCAAAAACTGAAACAAATCAACAACTGGGCTCCCTCCTCACCCATTTC              
+       145645563       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:2302:16529:90827/1
                                                                    AAACAGAAACACTTGCATCCACACACACACACAGAAGAGAAGAGACAAGCATCATCAAAAACTGAAACAAATCAACAACTGGGCTCCCTCCTCACCCATTT               
+       145645566       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:2209:4054:76740/1
                                                              TAAGGGAAACAGAAACACTTGCATCCACACACACACACAGAAGAGAAGAGACAAGCATCATCAAAAACTGAAACAAATCAACAACTGGGCTCCCTCCTCAC             
+       145645567       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:2110:2653:6324/1
                                                              TAAGGGAAACAGAAACACTTGCATCCACACACACACACAGAAGAGAAGAGACAAGCATCATCAAAAACTGAAACAAATCAACAACTGGGCTCCCTCCTCAC             
+       145645567       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:1303:4839:52707/1
                                                        TATCTATAAGGGTAACAGAAACACTTGCATCCACACACACACACAGAAGAGAAGAGACAAGCATCATCAAAAACTGAAACAAATCAACAACTGGGCTCCCT           
+       145645566       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:2207:9082:15442/1
                                                  GTTCCATATCTATAAGGGAAACAGAAACACTTGCATCCACACACACACACAGAAGAGAAGAGACAAGCATCATCAAAAACTGATACAAATCAACAACTGGG         
+       145645546       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:2216:14774:37713/1
                                               AGGGTTCCATATCTATAAGGGAAACAGAAACGCTTGCATCCACACACACACACAGAAGAGAAGAGACAAGCATCATCAAAAACTGAAACAAATCAA         
+       145645523       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:1212:10023:72896/1
                                         TGTGTAAGGGTTCCATATCTATAAGGGAAACAGAAACACTTGCATCCACACACACACACAGAAGAGAAGAGACAAGCATCATCGAAAACTGAAACAAATCA          
+       145645565       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:2216:5700:53182/1
                                         TGTGTAAGGGTTCCATATCTATAAGGGAAACAGAAACACTTGCATCCACACACACACACAGAAGAGAAGAGACAAGCATCATCAAAAACTGAAACAAATCA          
+       145645563       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:1106:18885:45479/2
                              TAAAAAGTCCTTGTGTAAGGGTTCCATATCTATAAGGGAAACAGAAACACTTGCATCCACACACACACACAGAAGAGAAGAGACAAGCATCATCAAAAACT             
+       145645502       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:2311:2742:60334/1
                           TCTTAAAAAGTCCTTGTGTAAGGGTTCCATATCTATAAGGGAAACAGAAACACTTGCATCCACACACACACACAGAAGAGAAGAGACAAGCATCATCAAAA                
+       145645537       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:2214:20403:98401/1
                           TCTTAAAAAGTCCTTGTGTAAGGGTTCCATATCTATAAGGGAAACAGAAACACTTGCATCCACACACACACACAGAAGAGAAGAGACAAGCATCATCAAAA                
+       145645537       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:2207:18755:26282/1
                           TCTTAAAAAGTCCTTGTGTAAGGGTTCCATATCTATAAGGGAAACAGAAACACTTGCATCCACACACACACACAGAAGAGAAGAGACAAGCATCATCAAAA                
+       145645568       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:1110:5277:17743/1
####################################################################################################
280     D 4     NT 3 "GAA"      ChrID chr5      BP 145806145    145806150       BP_range 145806145      145806150       Supports 3      2       1     1       2     1       S1 6    SUM_MS 180      1       NumSupSamples 1 1       C0443 1 1 2 1
GTGACATCAGTAAACAACAGTGCCATGTGAGTAAGGCCAAAGGATCTTGGTTTCTATCATAAATTCAAGCAAATTCAACAATATGAAACACCCCCTCACCA   TGGCTTGATTTAAAAATACACTCAGACAGTAGAAGCAGGAGCCTCAGAAATTCAAAGACAAAATTCAAAACTATATGAAATGTTTTAGACCTGCCTGAGAT
                                                               TTCAAGCAAATTCAACAATATGAAACACCCCCTCACCAGAATGGCTTGATTTAAAAATACACTCAGACAGTAGAAACAGGAGTCTCAGAAATTCAAAGACA            
-       145806372       60      C0443   @HWI-ST778:145:C1RF5ACXX:7:2215:6540:70269/2
                                                               TTCAAGCAAATTCAACAATATGAAACACCCCCTCACCAGAATGGCTTGATTTAAAAATACACTCAGACAGTAGAAACAGGAGTCTCAGAAATTCAAAGACA            
-       145806372       60      C0443   @HWI-ST778:145:C1RF5ACXX:7:1301:12004:59656/2
                                                                               AATATGAAACACCCCCTCACCAGAATGGCTTGATTTAAAAATACACTCAGACAGTAGAAACAGGAGTCTCAGAAATTCAAAGACAAAATTCAAAACCATAT            
+       145805780       60      C0443   @HWI-ST778:145:C1RF5ACXX:7:2106:3364:91429/2
####################################################################################################
281     D 26    NT 29 "GTAAGGGAAAGTAGAAAAGAACTTTGAAG"   ChrID chr5      BP 146261205    146261232       BP_range 146261205      146261232       Supports 11     9       8     7       3     2       S1 36   SUM_MS 319      1       NumSupSamples 1 1       C0443 8 7 3 2
GCTCTTCCTGGAGTCGGATTGCTTGGGAATGCAGCCCAAAGCGGGTGGTAAACTCCATCTAAGGCTAAATACCGGCACGAGACCGATAGTCAACAAGTACC                             AGAGAGTTCAAGAGGGCGTGAAACCGTTAAGAGGTAAACTGGTGGGGTCCGCGCAGTCCGCCCGGAGGATTCAACCCGGCGGCGCGCGTCCGCCATGCCGG
                                                                      ACCGGCACGAGACCGATAGTCAACAAGTACCGTAAGGGAAAGTAGAAAAGAACTTTGAAGAGAGAGTTCAAGAGGGCGTGAAACCGTTAAGAGGTAAACGG             
-       146261560       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:2303:4348:99716/2
                                                                      ACCGGCACGAGACCGATAGTCAACAAGTACCGTAAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGGGCGTGAAACCGTTAAGAGGAAAACGG             
-       146261560       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:1208:4133:85533/2
                                                                        CGGCACGAGACCGATAGTCAACAAGTACCGTAAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGGGCGTGAAACCGTTAAGAGGTAAACGGG            
-       146261560       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:2211:10099:97288/2
                                                                                        GTCAACAAGTACCGTAAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGGGCGTGAAACCGTTAAGAGGTAAACGGGTGGGGTCCGCGCAGTCC           
+       146260901       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:1312:9595:100309/2
                                                                                        GTCAACAAGTACCGTAAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGGGCGTGAAACCGTTAAGAGGTAAACGGGTGGGGTCCGCGCAGTCC           
+       146260901       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:1316:4495:14108/2
                                                                                            ACAAGTACCGTAAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGGGCGTGAAACCGTTAAGAGGTAAACGGGTGGGGTCCGCGCAGTCCGCCC               
+       146260904       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:1115:10666:13720/2
                                                                                 ACCGATAGTCAACAAGTACCGTAAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGGGCGTGAAACCGTTAAGAGGTAAACGGGTGGGGTCC            
+       146260891       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:2104:11397:19144/2
                                                                                         TCAACAAGTACCGTAAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGGGCGTGAAACCGTTAAGAGGTAAACGGGTGGGGTCCGCGCAGTCCG          
+       146261012       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:1313:15194:20080/2
                                                                            ACGAGACCGATAGTCAACAAGTACCGTAAGGGAAAGTTGAAAAGAACTTTGAAGAGAAAGTTCAAGAGGGCGTGAAACCGTTAAGAGGTAAACGGGTGGGG               
+       146260996       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:2103:21213:55739/2
                                                                            ACGAGACCGATAGTCAACAAGTACCGTAAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGA         
+       146260856       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:1307:6044:75864/2
                                                                CTAAATACCGGCACGAGACCGATAGTCAACAAGTACCGTAAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGGGCGTGAAACCGTTAAGAGGT           
+       146260998       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:2112:20449:23425/
I understand, which bases are inserted, but I can't see the deleted bases. Can somebody explain that for the three examples, please?

Best
Robby
Robby is offline   Reply With Quote
Old 07-07-2014, 05:47 AM   #12
KaiYe
Senior Member
 
Location: amsterdam

Join Date: Jun 2009
Posts: 133
Default

Quote:
Originally Posted by Robby View Post
Hello,
I have a problem to understand the Pindel output for deletions, if the deletion is not 'pure'. For example:

PHP Code:
279     D 24    NT 16 "GAAGAGAAGAGACAAG"        ChrID chr5      BP 145645795    145645820       BP_range 145645795      145645820       Supports 14     10      13    9       1     1       S1 28   SUM_MS 406      1       NumSupSamples 1 1       C0443 13 9 1 1
GAGCTTTGGGCCCAGGAATTCCCTGTTTCTTAAAAAGTCCTTGTGTAAGGGTTCCATATCTATAAGGGAAACGGAAACACTTGCATCCACACACACACACA                CATCATCAAAAACTGAAACAAATCAACAACTGGGCTCCCTCCTTGCCCATTTCCCAGAGAGCTTTGTGAATAGTGAATTTGCATGTTAGCCAATTGCTGCT
                                                       ATATCTATAAGGGAAACAGAAACACTTGCATCCACACACACACACAGAAGAGAAGAGACAAGCATCATCAAAAACTGAAACAAATCAACAACTG           
-       145646019       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:1315:2169:66627/1
                                                                     AACAGAAACACTTGCATCCACACACACACACAGAAGAGAAGAGACAAGCATCATCAAAAACTGAAACAAATCAACAACTGGGCTCCCTCCTCACCCATTTC              
+       145645563       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:2302:16529:90827/1
                                                                    AAACAGAAACACTTGCATCCACACACACACACAGAAGAGAAGAGACAAGCATCATCAAAAACTGAAACAAATCAACAACTGGGCTCCCTCCTCACCCATTT               
+       145645566       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:2209:4054:76740/1
                                                              TAAGGGAAACAGAAACACTTGCATCCACACACACACACAGAAGAGAAGAGACAAGCATCATCAAAAACTGAAACAAATCAACAACTGGGCTCCCTCCTCAC             
+       145645567       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:2110:2653:6324/1
                                                              TAAGGGAAACAGAAACACTTGCATCCACACACACACACAGAAGAGAAGAGACAAGCATCATCAAAAACTGAAACAAATCAACAACTGGGCTCCCTCCTCAC             
+       145645567       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:1303:4839:52707/1
                                                        TATCTATAAGGGTAACAGAAACACTTGCATCCACACACACACACAGAAGAGAAGAGACAAGCATCATCAAAAACTGAAACAAATCAACAACTGGGCTCCCT           
+       145645566       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:2207:9082:15442/1
                                                  GTTCCATATCTATAAGGGAAACAGAAACACTTGCATCCACACACACACACAGAAGAGAAGAGACAAGCATCATCAAAAACTGATACAAATCAACAACTGGG         
+       145645546       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:2216:14774:37713/1
                                               AGGGTTCCATATCTATAAGGGAAACAGAAACGCTTGCATCCACACACACACACAGAAGAGAAGAGACAAGCATCATCAAAAACTGAAACAAATCAA         
+       145645523       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:1212:10023:72896/1
                                         TGTGTAAGGGTTCCATATCTATAAGGGAAACAGAAACACTTGCATCCACACACACACACAGAAGAGAAGAGACAAGCATCATCGAAAACTGAAACAAATCA          
+       145645565       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:2216:5700:53182/1
                                         TGTGTAAGGGTTCCATATCTATAAGGGAAACAGAAACACTTGCATCCACACACACACACAGAAGAGAAGAGACAAGCATCATCAAAAACTGAAACAAATCA          
+       145645563       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:1106:18885:45479/2
                              TAAAAAGTCCTTGTGTAAGGGTTCCATATCTATAAGGGAAACAGAAACACTTGCATCCACACACACACACAGAAGAGAAGAGACAAGCATCATCAAAAACT             
+       145645502       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:2311:2742:60334/1
                           TCTTAAAAAGTCCTTGTGTAAGGGTTCCATATCTATAAGGGAAACAGAAACACTTGCATCCACACACACACACAGAAGAGAAGAGACAAGCATCATCAAAA                
+       145645537       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:2214:20403:98401/1
                           TCTTAAAAAGTCCTTGTGTAAGGGTTCCATATCTATAAGGGAAACAGAAACACTTGCATCCACACACACACACAGAAGAGAAGAGACAAGCATCATCAAAA                
+       145645537       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:2207:18755:26282/1
                           TCTTAAAAAGTCCTTGTGTAAGGGTTCCATATCTATAAGGGAAACAGAAACACTTGCATCCACACACACACACAGAAGAGAAGAGACAAGCATCATCAAAA                
+       145645568       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:1110:5277:17743/1
####################################################################################################
280     D 4     NT 3 "GAA"      ChrID chr5      BP 145806145    145806150       BP_range 145806145      145806150       Supports 3      2       1     1       2     1       S1 6    SUM_MS 180      1       NumSupSamples 1 1       C0443 1 1 2 1
GTGACATCAGTAAACAACAGTGCCATGTGAGTAAGGCCAAAGGATCTTGGTTTCTATCATAAATTCAAGCAAATTCAACAATATGAAACACCCCCTCACCA   TGGCTTGATTTAAAAATACACTCAGACAGTAGAAGCAGGAGCCTCAGAAATTCAAAGACAAAATTCAAAACTATATGAAATGTTTTAGACCTGCCTGAGAT
                                                               TTCAAGCAAATTCAACAATATGAAACACCCCCTCACCAGAATGGCTTGATTTAAAAATACACTCAGACAGTAGAAACAGGAGTCTCAGAAATTCAAAGACA            
-       145806372       60      C0443   @HWI-ST778:145:C1RF5ACXX:7:2215:6540:70269/2
                                                               TTCAAGCAAATTCAACAATATGAAACACCCCCTCACCAGAATGGCTTGATTTAAAAATACACTCAGACAGTAGAAACAGGAGTCTCAGAAATTCAAAGACA            
-       145806372       60      C0443   @HWI-ST778:145:C1RF5ACXX:7:1301:12004:59656/2
                                                                               AATATGAAACACCCCCTCACCAGAATGGCTTGATTTAAAAATACACTCAGACAGTAGAAACAGGAGTCTCAGAAATTCAAAGACAAAATTCAAAACCATAT            
+       145805780       60      C0443   @HWI-ST778:145:C1RF5ACXX:7:2106:3364:91429/2
####################################################################################################
281     D 26    NT 29 "GTAAGGGAAAGTAGAAAAGAACTTTGAAG"   ChrID chr5      BP 146261205    146261232       BP_range 146261205      146261232       Supports 11     9       8     7       3     2       S1 36   SUM_MS 319      1       NumSupSamples 1 1       C0443 8 7 3 2
GCTCTTCCTGGAGTCGGATTGCTTGGGAATGCAGCCCAAAGCGGGTGGTAAACTCCATCTAAGGCTAAATACCGGCACGAGACCGATAGTCAACAAGTACC                             AGAGAGTTCAAGAGGGCGTGAAACCGTTAAGAGGTAAACTGGTGGGGTCCGCGCAGTCCGCCCGGAGGATTCAACCCGGCGGCGCGCGTCCGCCATGCCGG
                                                                      ACCGGCACGAGACCGATAGTCAACAAGTACCGTAAGGGAAAGTAGAAAAGAACTTTGAAGAGAGAGTTCAAGAGGGCGTGAAACCGTTAAGAGGTAAACGG             
-       146261560       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:2303:4348:99716/2
                                                                      ACCGGCACGAGACCGATAGTCAACAAGTACCGTAAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGGGCGTGAAACCGTTAAGAGGAAAACGG             
-       146261560       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:1208:4133:85533/2
                                                                        CGGCACGAGACCGATAGTCAACAAGTACCGTAAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGGGCGTGAAACCGTTAAGAGGTAAACGGG            
-       146261560       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:2211:10099:97288/2
                                                                                        GTCAACAAGTACCGTAAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGGGCGTGAAACCGTTAAGAGGTAAACGGGTGGGGTCCGCGCAGTCC           
+       146260901       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:1312:9595:100309/2
                                                                                        GTCAACAAGTACCGTAAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGGGCGTGAAACCGTTAAGAGGTAAACGGGTGGGGTCCGCGCAGTCC           
+       146260901       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:1316:4495:14108/2
                                                                                            ACAAGTACCGTAAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGGGCGTGAAACCGTTAAGAGGTAAACGGGTGGGGTCCGCGCAGTCCGCCC               
+       146260904       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:1115:10666:13720/2
                                                                                 ACCGATAGTCAACAAGTACCGTAAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGGGCGTGAAACCGTTAAGAGGTAAACGGGTGGGGTCC            
+       146260891       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:2104:11397:19144/2
                                                                                         TCAACAAGTACCGTAAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGGGCGTGAAACCGTTAAGAGGTAAACGGGTGGGGTCCGCGCAGTCCG          
+       146261012       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:1313:15194:20080/2
                                                                            ACGAGACCGATAGTCAACAAGTACCGTAAGGGAAAGTTGAAAAGAACTTTGAAGAGAAAGTTCAAGAGGGCGTGAAACCGTTAAGAGGTAAACGGGTGGGG               
+       146260996       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:2103:21213:55739/2
                                                                            ACGAGACCGATAGTCAACAAGTACCGTAAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGA         
+       146260856       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:1307:6044:75864/2
                                                                CTAAATACCGGCACGAGACCGATAGTCAACAAGTACCGTAAGGGAAAGTTGAAAAGAACTTTGAAGAGAGAGTTCAAGAGGGCGTGAAACCGTTAAGAGGT           
+       146260998       29      C0443   @HWI-ST778:145:C1RF5ACXX:7:2112:20449:23425/
I understand, which bases are inserted, but I can't see the deleted bases. Can somebody explain that for the three examples, please?

Best
Robby
If you convert output file to vcf, the ref and alt alleles will be reported. Indeed the deleted sequence is not displayed in the raw output but this was the way I designed.
KaiYe is offline   Reply With Quote
Reply

Tags
inversion, large insertion, pindel

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 07:52 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO