SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
processing pindel output files odoyle81 Bioinformatics 9 01-17-2017 10:10 PM
Interpreting Pindel output bwubb Bioinformatics 11 07-07-2014 05:47 AM
Pindel- empty output? Seq_student Bioinformatics 12 08-15-2013 12:30 PM
understanding dwgsim_eval output oiiio Bioinformatics 12 08-15-2011 04:10 PM
my understanding for cuffdiff output Huijuan Bioinformatics 1 05-01-2011 04:42 AM

Reply
 
Thread Tools
Old 01-21-2013, 05:49 AM   #1
frymor
Senior Member
 
Location: Germany

Join Date: May 2010
Posts: 150
Angry understanding pindel output

Hi everybody,

I really tried to understand the different files I get when running pindel with the following command:
Code:
pindel -f Mus_musculus.NCBIM37.66.dna.fa -i bwa_trimmedData.txt -c ALL -o rimmedData_default
Well, I get a list of 7 different files - BP, INV, D, LI, SI, TD and CloseEndMapped, some of them are empty, some are not.
When I tried to understand the results I compared my output to the one on the pindel web site. Unfortunately it was not possible.

Here is an example of LI
Code:
########################################################
0	LI	ChrID MT1	790	+ 4	791	- 4	A_bwa_trimmed75_default + 3 - 3	G_default + 1 - 1
GTATTAAAGTAAGCAAAAGAATCAAACATAAAAACGTTAGGTCAAGGTGTAGCCAATGAAATGGGAAGAAATGGGCTACAttttcttataaaagaacattactataccctttatgaaactaaaggactaaggaggatttagtagtaaattaagaatagag
                                                                      ATTGGCTACACCTTGACCTAACGTTTTTATGTTTGATTCTTTTGCTTACTTTAATACCTTTTTAGGGGTTGCTGAAGATG	+	22	60	A_default	@HWI-ST863:138:D0WT7ACXX:5:1210:19323:84582/2
                                                                      ATTGGCTACACCTTGACCTAACGTTTTTATGTTTGATTCTTTTGCTTACTTTAATACCTTTTTAGGGGTTGCTGAAGATG	+	106	60	A_default	@HWI-ST863:138:D0WT7ACXX:5:1308:13343:59960/2
                                                                      ATTGGCTACACCTTGACCTAACGTTTTTATGTTTGATTCTTTTGCTTACTTTAATATCTTTTTAGGGTTTGCTGAAGATG	+	145	60	A_default	@HWI-ST863:138:D0WT7ACXX:5:2108:5597:62957/1
                                                                      ATTGGCTACACCTTGACCTAACGTTTTTATGTTTGATTCTTTTGCTTACTNTAATACCTTTTTAGGGTTTGCTGAAGATG	+	69	60	G_default	@HWI-ST863:138:D0WT7ACXX:5:2209:8563:77307/2
--------------------------------------------------------
gtattaaagtaagcaaaagaatcaaacataaaaacgttaggtcaaggtgtagccaatgaaatgggaagaaatgggctacaTTTTCTTATAAAAGAACATTACTATACCCTTTATGAAACTAAAGGACTAAGGAGGATTTAGTAGTAAATTAAGAATAGAG
          CTAGATGGATATAAAGTACCGCCAAGTCCTTTGAGTTTTAAGCTATGGCTAGTAGTTCTCTGGCAAATAGTTTTGTTATA	-	1219	60	A_default	@HWI-ST863:138:D0WT7ACXX:5:2316:6189:1992/2
                                           CAAGGGGGAGCCAATGAAAGGAGAAGGATTATGCTAGATTTTCTTATAAAAGGACATTACTATACCATTTATGAAACTAA	-	1573	29	A_bwa_trimmed75_default	@HWI-ST863:138:D0WT7ACXX:5:2316:16450:36161/2
         TATATTGTTTATTACCATGTATATCTTTTCTTTTTTTTGTTATAATCTAATCTTTTTTTTTTTTTTTTTTTTTTTTTTAT	-	2175	29	A_default	@HWI-ST863:138:D0WT7ACXX:5:1206:12241:67098/2
          TTTTTTTTTTTTTTGTTTTTATTTCTAAAAAATAATTTTTCATATAAATTTTGTTTTTTATTTTTTTTTTTTTTTTTATA	-	1171	29	G_default	@HWI-ST863:138:D0WT7ACXX:5:2304:2584:12569/2
########################################################
I would like to know how to understand this list.
somehow the results from pindel doesn't match the bam file.
here is the sequence from the bam file for the last read from above:
Code:
 samtools view G.bam | grep "HWI-ST863:138:D0WT7ACXX:5:2304:2584:12569"
HWI-ST863:138:D0WT7ACXX:5:2304:2584:12569       89      MT      582     50      90M     *       0       0       CTCAAAGGACTTGGCGGTACTTTATATCCATCTAGAGGAGCCTGTTCTATAATCGATAAACCCCGCTCTACCTCACCATCTCTTGCTAAT      BCDCCDDDCBBB>B@DDCBDEDEDDDCDDDDEDEEEDFFFFHGHHHJJJIJJIJJJIHA?JJJJJJJJHGJJIHFJIHFHHHFFFFFCCB      AS:i:0       XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:90 YT:Z:UU NH:i:1
the mapping qualities differ in both results, the positions are not the same. I find it quite difficult to interpret the results to an understandable read list.
Another fact I don't understand is the difference in the sequence. What do the letters in upper case stand for? what is the different between them to the lower case?
Where can I see the beginning of my insertion?

Is there a better manual to this software?
Is there a way to visualize the results, so that I can see the reads as an alignment?

Thanks
Assa

Last edited by frymor; 01-21-2013 at 05:59 AM. Reason: some more questions
frymor is offline   Reply With Quote
Old 01-22-2013, 01:44 PM   #2
KaiYe
Senior Member
 
Location: amsterdam

Join Date: Jun 2009
Posts: 133
Default

Indeed the Pindel documentation needs more work. Sorry for the inconvenience. Jirapong helped me on the text and I still need to update the wiki site. I will update the wiki site this week and give you a signal when I finish.

Kai
KaiYe is offline   Reply With Quote
Reply

Tags
bwa, indel, indel analysis, output, pindel

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 12:37 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO