SEQanswers

Go Back   SEQanswers > Applications Forums > Sample Prep / Library Generation



Similar Threads
Thread Thread Starter Forum Replies Last Post
Using RNA 6000 pico chips for final library QC pmiguel Illumina/Solexa 15 03-05-2012 07:42 AM
Truseq Small RNA kit - losing library in the final cleanup? Tali7 Sample Prep / Library Generation 3 10-12-2011 04:26 AM
primer/adapter sequences nikiwilson Sample Prep / Library Generation 2 06-21-2011 02:36 PM
TruSeq Sample Prep, Enrichment PCR primer sequences EdibleMetal Sample Prep / Library Generation 11 04-13-2011 12:15 PM
who know extract linker/Primer sequences for HTS sequencing? feng Bioinformatics 2 10-26-2010 03:19 PM

Reply
 
Thread Tools
Old 01-29-2012, 04:00 PM   #1
Dario1984
Senior Member
 
Location: Sydney, Australia

Join Date: Jun 2011
Posts: 163
Default Typical Quantity of Primer Sequences In Final Library

Hello,

I'm wondering what amount of contamination is typical of a multiplexed library ? We've just done our first ever multiplexing run through a service provider on the HiSeq for a number of ChIP-seq experiments against histone mark H2A.Z. Here is FASTQC output for one sample :

Basic Statistics
Total Sequences 35111957
Sequence length 51

Overrepresented sequences
Sequence Count Percentage Possible Source
ATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCG 2115847 6.026001341936025 Multiplexing_PCR_Primer_2.01 (100% over 32bp)
GAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTG 1385332 3.945470769402002 PCR_Primer_Index_7 (100% over 39bp)
AGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCT 910631 2.5935068216220474 PCR_Primer_Index_7 (100% over 38bp)
GGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCT 413853 1.1786668569911953 PCR_Primer_Index_7 (100% over 35bp)
GAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTT 177781 0.5063260928463771 PCR_Primer_Index_7 (100% over 36bp)
AGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGC 169413 0.48249375561721036 PCR_Primer_Index_7 (100% over 40bp)
AAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTC 154312 0.4394856145443559 PCR_Primer_Index_7 (100% over 37bp)
CGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTC 128319 0.36545670182952206 PCR_Primer_Index_7 (100% over 34bp)
GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCC 117745 0.33534160457077344 Multiplexing_PCR_Primer_2.01 (100% over 33bp)
GCACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCT 94592 0.2694011045866797 PCR_Primer_Index_7 (100% over 41bp)
ACACGTCTGAACTCCAGTCACCAGATCATCTCGTATGCCGTCTTCTGCTTG 47410 0.1350252280156301 PCR_Primer_Index_7 (100% over 43bp)

Also, are there any protocol tricks so that tags aren't being wasted just sequencing primers ?

I realise there's also the problem of overamplification here (3.5 million unique mapping reads with Bowtie). I hear that happens often when indexes are used ?
Dario1984 is offline   Reply With Quote
Old 03-05-2012, 07:44 AM   #2
jlove
Member
 
Location: Boston, MA

Join Date: Apr 2011
Posts: 49
Default

Dario,
It sounds like you're doing ChIP Seq... are you using the TruSeq kit? If so, I can tell you what we do. I use 10 to no more than 50 ng of input as measured by pico green, and a 1:50 dilution of the adapters. Usually 15-18 cycles of PCR are required. I also do the size selection AFTER the PCR, which removes any dimer.
jlove is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:47 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO