Stopped MiSeq run

[memento]

Hi,
I experienced first problems with our MiSeq. This morning with new run loaded there was a flow rate error - first thought, valve.....
Did re-test at 250ul (failed) and 500ul (machine freezed) so had to restart. While restart I re-seated the flow cell and I managed to pass the flow rate check (no other issues). After 1h run stopped - error msg that was thrown is related to "no clusters detected". We managed to do couple runs on it with no problems (300 cycle / 500 cycle / nano and regulars). This is updated v2 version (with recently updated software).
Is this a prelude to valve problems (already reported in our collaborators lab) ?
Thanks!

[kwaraska]

A no cluster error is thrown when there is nothing to see OR a sample with no diversity. If it sees all the same base at each position for the first 5 bases, it assumes everything is junk and will stop the run.

I know this because it happened to me. When we spoke to the customer (we are a core) they told us there was no diversity on the first 10 or so bases. When we reran with a PhiX spike in-no problem.

[memento]

There was big diversity of the amplicons sequenced (more than 300 totally different ones) plus some phix... Thanks for a quick reply!

[kcchan]

Were you using the correct sequencing primers for your amplicons? That would also give you a no clusters error message.

MiSeq v2 has a newly designed valve, so it shouldn't have the same problems the earlier instruments experienced.

[memento]

kcchan,

I checked the setting under sample sheet. last 3 runs (successful!) I had a different "adapter" sequence in my sample sheet csv - would that cause that??

[GenoMax]

I suppose you have already contacted Illumina tech support/local FAS. If there is something wrong with your MiSeq hardware then none of us are going to be of much help.

[memento]

Techsup asked me to run few tests. Volume test failed on PR2 sipper....I guess no wonder there was nothing detected if the incorporation buffer didnt find its way to a flow cell...
looks like hardware.
are they any fast with repairs ?
thanks!

[ECO]

PR2 sipper fails often and is not a cause for concern.

Did it make any images? I'm sure tech support will ask for your MCS and cycle logs...but you can poke around in there to see what the error might be (searching for "ERR:" is most helpful.

[memento]

MCS was not able to eastablish focus model as the result of low intensity...
they also said that PR2 is a common issue and not a real problem...

[memento]

I used these primers to enrich my library:
Forward:
aatgatacggcgaccaccgagatctacactctttccctacacgacgctcttc
reverse:
caagcagaagacggcatacgagatcggtctcggcattcctgctgaacc

[memento]

what is more interesting. If I used i7 barcode (index1):
Reverse primer used to enrich:
caagcagaagacggcatacgagatCCTGCGAcggtctcggcattcctgctgaacc

Do I have to use custom index1 primer to read it or the MiSeq flow cell primer will work with this ?
THanks!

[MLog]

Hi memento,

have you found what was the reason of failed run? Was this an instrument issue or rather reagents/library?
I'm asking because I got the same error from our Miseq last week. If this is a reagent issue, I would like to retry with a new kit. The samples need to be sequenced quite urgently.

[memento]

@ MLog
When this problem arises, usually the flow cell is not seated properly. You have to open the flow cell compartment and re-seat the flow cell. If there was a spill all over the flow cell, You should clean the flow cell first. At that particular problem this helped.
Just now, after illumina replaced our v1 valve to v3 valve I experienced the same problem. This time though, re-seating the flow cell didnt help...illumina tech is coming today to help...
You can keep the reagents @ 2-8C for ~ 1 week. Flow cell should be intact (unless it is a flowcell's gasket that caused flow-rate error).

[MLog]

I checked the flowcell, it looked perfectly OK and was delivering proper volumes of water during washes. So we retried with another kit and it worked without any problems. Looks like this no clusters error might be a reagent issue, too.

[d00b]

Your flowcell problem

This is flowcell issue. the inlet of the gasket was not well aligned to the injector port. it will make this kind of error. you need to request replacement for the reaction kit and other supply material for index library prep.