SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
MiSeq Custom Sequencing Primer Tm? pmiguel Illumina/Solexa 43 11-12-2015 11:52 AM
Custom primer failed kal33na Illumina/Solexa 1 04-22-2013 01:39 PM
best 16s region to amplify with NGS ? dph Metagenomics 6 07-02-2012 04:26 PM
50+% of my HiSEQ reads are 3' primer (custom primer used) ZAAB Sample Prep / Library Generation 3 02-06-2012 11:00 AM
custom primer menglv Illumina/Solexa 3 01-18-2011 01:01 PM

Reply
 
Thread Tools
Old 11-12-2012, 06:23 PM   #1
lmma
Junior Member
 
Location: USA

Join Date: Mar 2012
Posts: 2
Default Miseq Custom primer for 16s V1V3 region

Hi Guys,
I am trying to come up with my own amplification and sequencing primers for 16s V1V3 region and I would like to get help with primer design.
I think Caporaso primer for V4 region is a good start to do modifications on. I want to understand how the primer pad was designed. In his paper, the explanation for pad region is "The amplification and sequencing primers additionally contain a new pad region to avoid primer-dimer formation with the modified adapter. " But I still don't know how to adapt this for other variable regions. Any ideas?


515F (forward primer) PCR primer sequence:
Field number (space-delimited), description:
1, 5' Illumina adapter
2, Forward primer pad
3, Forward primer linker
4, Forward primer

AATGATACGGCGACCACCGAGATCTACAC TATGGTAATT GT GTGCCAGCMGCCGCGGTAA

806R (reverse primer) PCR primer sequence (each sequence contains different barcode):
2168 GoLay barcoded reverse PCR primers. Each primer is followed by a barcode identifier
generated specifically for this set of primers.
Field number (space-delimited), description:
1, Reverse complement of 3′ Illumina adapter
2, Golay barcode
3, Reverse primer pad
4, Reverse primer linker
5, Reverse primer
CAAGCAGAAGACGGCATACGAGAT TCCCTTGTCTCC AGTCAGTCAG CC GGACTACHVGGGTWTCTAAT 806rcbc0

Read 1: (TATGGTAATTGTGTGCCAGCMGCCGCGGTAA)
Index: (ATTAGAWACCCBDGTAGTCCGGCTGACTGACT)
Read 2: (AGTCAGTCAGCCGGACTACHVGGGTWTCTAAT)

Last edited by lmma; 11-13-2012 at 08:29 AM.
lmma is offline   Reply With Quote
Old 11-28-2012, 12:21 PM   #2
kkrishnan
Junior Member
 
Location: USA

Join Date: Nov 2012
Posts: 5
Default

Hi Imma,
Just wondering if you have attempted and succeeded in designing primers for the V1V3 regions? I am about to try the same and any help would be great! Thanks!
kkrishnan is offline   Reply With Quote
Old 12-04-2012, 09:53 AM   #3
csquared
Member
 
Location: Huntsville, AL

Join Date: May 2008
Posts: 67
Default

The Caporaso primers are great primers and an elegant design. If you want to cover V1-V3 rather than V4, you can make an easy change to use 27F and 534R from the human microbiome project:

27F Forward
AATGATACGGCGACCACCGAGATCTACAC TATGGTAATT GT AGAGTTTGATCCTGGCTCAG

534R Reverse (rcbc0)
CAAGCAGAAGACGGCATACGAGAT TCCCTTGTCTCC AGTCAGTCAG CC ATTACCGCGGCTGCTGG

Read 1: (TATGGTAATTGTAGAGTTTGATCCTGGCTCAG)
Index: (CCAGCAGCCGCGGTAATGGCTGACTGACT)
Read 2: (AGTCAGTCAGCCATTACCGCGGCTGCTGG)

Please verify all of the above sequences. I did the conversion a bit quickly but they should be correct.
__________________
HudsonAlpha Institute for Biotechnology
http://www.hudsonalpha.org/gsl
csquared is offline   Reply With Quote
Old 12-04-2012, 10:16 AM   #4
lmma
Junior Member
 
Location: USA

Join Date: Mar 2012
Posts: 2
Default

Thanks for your replies and suggestions. I am currently validating my primers that are very similar to Caporaso primers with Miseq and will update you shortly.
lmma is offline   Reply With Quote
Old 01-21-2013, 06:10 AM   #5
liepa
Junior Member
 
Location: Germany

Join Date: Sep 2012
Posts: 4
Default

Quote:
Originally Posted by lmma View Post
Thanks for your replies and suggestions. I am currently validating my primers that are very similar to Caporaso primers with Miseq and will update you shortly.
It would be interesting to know your results as I was thinking of the same "easy convertion" and usage of V1V3 primers from 454 sequencing? Would you consider using only one index?

Last edited by liepa; 01-21-2013 at 06:18 AM.
liepa is offline   Reply With Quote
Old 01-31-2013, 11:58 AM   #6
fozrun
Junior Member
 
Location: Alberta

Join Date: Jan 2010
Posts: 6
Default validating primers

Quote:
Originally Posted by lmma View Post
Thanks for your replies and suggestions. I am currently validating my primers that are very similar to Caporaso primers with Miseq and will update you shortly.
Hi Imma:

Did you get your primers to work? Do they have the staggered pad so that you don't need to use PhiX? I can't seem to get e-mail or messaging to work. We're soon taking delivery of a MiSeq and want to get prepared.

Could you e-mail me at forsterr at agr dot gc dot ca

Thanks.
fozrun is offline   Reply With Quote
Old 04-23-2013, 11:33 AM   #7
lotijeo
Junior Member
 
Location: Oregon

Join Date: Apr 2013
Posts: 3
Default MiSeq amplicon paired-end libraries

Hi Imma,
I was wondering you got any positive results using the protocol from Caporaso et al 2012. I would also like to adopt the same approach and customize some gene-specific primers using their approach. Any insights would be very appreciated.
Thanks
lotijeo is offline   Reply With Quote
Old 01-11-2015, 03:32 PM   #8
rohan_dandage
Junior Member
 
Location: new delhi

Join Date: Oct 2014
Posts: 3
Default

Hello,
I have a related query. I am set out to do an amplicon sequencing on miseq. Going through the library architectures (Illumina TruSeq DNA Adapters De-Mystified Illumina - all flavors) and adapter sequences (Illumina Customer Sequence Letter (August 12, 2014)), I have designed a strategy involving 3 simple PCR steps which skips all of recommended-kit-based-library preparation. Please have a look.

where,
P5: part of adapter that attaches to flowcell 29 nt :AATGATACGGCGACCACCGAGATCTACAC
P7: part of adapter that attaches to flowcell 24 nt :CAAGCAGAAGACGGCATACGAGAT
Read 1 : sequencing primer 33nt :ACACTCTTTCCCTACACGACGCTCTTCCGATCT
Read 2: sequencing primer 33nt :GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC
i5 :barcode 8nt
i7 : barcode 8nt

PCR1: For primer:ACACTCTTTCCCTACACGACGCTCTTCCGATCT<template for 10bp>
PCR1: Rev primer:GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC<template rev 10bp>
PCR2: For primer:GATCTACAC<i5 8nt>ACACTCTTT
PCR2: Rev primer:ATACGAGAT<i7 8nt>GTGACTGGA
PCR3: For primer:P5
PCR3: Rev primer:P7

For plexing 48 samples I would require only 24 (2+12(i5) +8(i7) +2) primers, a standard high fidelity pol and gel purification. I am very skeptical about mainly because of posts mentioning that illumina adapters are methylated so custom primers dont work and also the fact that if the process was so simple, the expensive kits may not be existing!
If anybody has any idea whether this kind of tinkering works or not, please let me know. As a test I will be doping a single such library next week. I would let know the result. Thanks.

Last edited by rohan_dandage; 01-11-2015 at 03:38 PM.
rohan_dandage is offline   Reply With Quote
Old 01-22-2015, 05:32 AM   #9
JBKri
Member
 
Location: Greece

Join Date: Jan 2014
Posts: 75
Default

Quote:
Originally Posted by rohan_dandage View Post

For plexing 48 samples I would require only 24 (2+12(i5) +8(i7) +2) primers, a standard high fidelity pol and gel purification. I am very skeptical about mainly because of posts mentioning that illumina adapters are methylated so custom primers dont work and also the fact that if the process was so simple, the expensive kits may not be existing!
If anybody has any idea whether this kind of tinkering works or not, please let me know. As a test I will be doping a single such library next week. I would let know the result. Thanks.
Did you try it? Did it work?
Jon
JBKri is offline   Reply With Quote
Old 01-22-2015, 10:07 PM   #10
rohan_dandage
Junior Member
 
Location: new delhi

Join Date: Oct 2014
Posts: 3
Default

@JBKri: I did not try actually. As ILMN won't support such strategies, I am still seeking for expert advise first.
rohan_dandage is offline   Reply With Quote
Old 02-25-2015, 12:26 AM   #11
hadarneuman
Junior Member
 
Location: Israel

Join Date: Feb 2015
Posts: 1
Default

Has anyone actually used the 27F primer for Miseq? My runs didn't succeed, probably due to low Tm and low GC content of the Caporaso Read1 primer (TATGGTAATT TC AGAGTTTGATCCTGGCTCAG)... Any ideas of how to change the primer pad in order to add more GC content?
Thanks!
Hadar
hadarneuman is offline   Reply With Quote
Old 02-25-2015, 06:15 PM   #12
bunce
Member
 
Location: Perth

Join Date: Sep 2012
Posts: 55
Default

Hi Hadarneuman, I would look into using locked-nucleic acid (LNA's) embedded into your sequencing primer. Fluidigm use it (e.g. A+CA+CTG+ACGACATGGTTCTACA) to artificially raise the Tm of the sequencing primer. We have found LNA-custom primers work fine - consensus seems to be to put the LNA bases at the 5' end. They are expensive but worth it if you are planning on doing a lot of sequencing with the single assay. Check out this link for more info; http://www.exiqon.com/lna-technology
Cheers, Mike
bunce is offline   Reply With Quote
Old 02-26-2015, 01:13 PM   #13
nangel
Member
 
Location: Brisbane, Australia

Join Date: Nov 2014
Posts: 13
Default

We routinely use 27F primer for Miseq (AGAGTTTGATCMTGGCTCAG). Haven't had any issues when compared to other primer sets that we have in use. When you say that your runs didn't succeed is it in failure to cluster in the sequencing run? We get usual cluster numbers and Q scores. Sample type makes a big difference in amplicon generation obviously.
nangel is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 06:01 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO