SEQanswers

Go Back   SEQanswers > Introductions



Similar Threads
Thread Thread Starter Forum Replies Last Post
How to fetch sequence from chromosome coordinates kumardeep Bioinformatics 6 05-29-2015 01:40 AM
reads mapping to highly similar genes using bowtie ndeshpan Bioinformatics 0 02-24-2015 03:05 PM
Galaxy Fetch Sequence for negative Strand Fernas Bioinformatics 0 12-22-2013 11:10 AM
Ensembl database fetch sequence problem roger770507 Bioinformatics 2 12-02-2013 01:56 AM

Reply
 
Thread Tools
Old 10-04-2017, 12:14 PM   #1
Misbah Abbas
Junior Member
 
Location: Islamabad.pakistan

Join Date: Jun 2017
Posts: 2
Post Script for Align some pattren and fetch highly similar sequence from gene

hello

I am new in programming, i want to match pattren in fasta sequence and extract sequence from fasta file
for example here is fasta sequence is
>geneA
ATGTGCACGAGACGTCTGGTCGTCGTCGTCGCTGCGCGCGCGTATTAACCCCGCGGCTTTTCTTTCTT
>pattren
ATGGCGTTCGTATTAACC

i need a script which align pattren and fetch highly similar sequence from geneA.
Misbah Abbas is offline   Reply With Quote
Reply

Tags
alignement, command, script

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 06:31 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2017, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO