SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
Concentration Illumina Index adapters Kaizen RNA Sequencing 0 01-25-2017 05:27 AM
Ligation of Illumina adapters to custom adapters ale Sample Prep / Library Generation 2 02-29-2016 12:42 AM
V4 16s Amplification for Sequencing via Illumina Hiseq 2000 -> Multiple bands! adw222 Sample Prep / Library Generation 4 02-08-2013 06:14 AM
Length of P5 and P7 adapters from Illumina Gina_P Illumina/Solexa 1 01-12-2012 12:17 PM
DIY illumina adapters ZAAB Illumina/Solexa 0 05-03-2011 07:00 AM

Reply
 
Thread Tools
Old 06-05-2018, 05:40 PM   #1
lavamartin
Junior Member
 
Location: Auckland

Join Date: Jun 2018
Posts: 1
Post Non-specific bands when using Illumina adapters?

Hi all,
I am new to the Illumina system. When I did the PCR and ran the gel using normal sets of primers. Everything is nice and clean. However, when I used the primers with Illumina adapters. I got non-specific bands and smear. Can someone help me please?
PCR conditions are the same for both with/without the adapters.

16S primers: 515'F/926r

GTGBCAGCMGCCGCGGTAA
CCGYCAATTYMTTTRAGTTT

16S primers with adapters:

5'[TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG]GTGBCAGCMGCCGCGGTAA-3'
5[GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG]CCGYCAATTYMTTTRAGTTT-3'

16S PCR condition:

95 C - 5 min
35 cycles of 95 C - 30 sec/ 55.5 C - 30 sec / 72 C - 30 sec
72 C - 10 min

18S primers: Euk1391f/EukBr

GTACACACCGCCCGTC
TGATCCTTCTGCAGGTTCACCTAC

with adapters:
5[TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG]GTACACACCGCCCGTC-3'
5[GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG]TGATCCTTCTGCAGGTTCACCTAC-3'

18S PCR condition:

94C - 3 min
35 cycles of 94C - 45 sec/ 57C - 60 sec/ 72C - 90 sec
72C - 10 min

These are all environmental DNA which the original extracted DNA concentration are very low.

Thank you!
Kitty
lavamartin is offline   Reply With Quote
Old 06-20-2018, 03:48 AM   #2
t.m.wasiak
Junior Member
 
Location: Lodz

Join Date: Aug 2017
Posts: 1
Default

Hi Kitty,

This is typhical for Illumina primers witha adapters. This method works only for a highly good DNA template. I suggest you use the protocol Kircher&Meyer (https://www.ncbi.nlm.nih.gov/pubmed/20516186). For metagenomics we're using primers (V3 region of 16S rRNA):
F: CCTACGGGRSGCAGCAG
R: ACCGCGGCKGCTGGC
Polymerase KAPA HiFi, reaction with addition of 3% DMSO (we work on ancient DNA, if you have modern DNA samples, DMSO supplement is unnecessary but you can try with it).
PCR protocol:
95C - 2min
29 cycles (when we made more cycles we got bands in blak sample)
98C - 20 sec
54C - 20 sec
72C - 15 sec
72C - 5 min
4C -

Next stepas are in Kircher&Mayer protocol:

Blut end by - NewEngland Quik Blunting Kit
Adapter ligation - NewEngland Quik Ligation Kit
Adapter fill-in - NewEngland Bst polymerase
Indexing raction - KAPA HiFi

If you have aditional question fell free.

All the best
Tomek
t.m.wasiak is offline   Reply With Quote
Reply

Tags
gel, illumina, illumina adapters, non-specific band, pcr

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 05:31 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO