SEQanswers

Go Back   SEQanswers > Applications Forums > RNA Sequencing



Similar Threads
Thread Thread Starter Forum Replies Last Post
Is it possible to convert a SNP.txt to a bed file or get a SNP.bed from samtools? Ling Bioinformatics 7 04-02-2015 06:17 AM
Splitting a bed file in multiple bed files by track albireo Bioinformatics 3 12-18-2014 11:58 AM
Updated How to convert .txt file to .bed .GFF or .BAR file format, forevermark4 Bioinformatics 2 06-30-2014 05:02 AM
compare genomic features from gff file to a SAM/BED file jazz Bioinformatics 8 11-04-2013 11:04 PM
Is there a BED file format validator? Does a BED file have to be sorted position? LauraSmith Bioinformatics 3 05-21-2013 11:54 AM

Reply
 
Thread Tools
Old 03-22-2015, 05:20 AM   #1
yueli
Member
 
Location: china

Join Date: May 2013
Posts: 71
Default *.bed file

Hi,

How I can produce the *.bed file?

I have two file: one is genome.fa and the other is RNA-seq.fa. Following is the RNA-seq.fa format.

Anyone can recommend the appropriate software to produce the *.bed file?

Thanks a lot!

Li

>t0000001_x537124
CCCGACCTCAGATCAGATGA
>t0000002_x340107
TCACCGGGTAGACATTCATTAT
>t0000003_x268409
TGAAAGACATGGGTAGTGAGAT
>t0000004_x172657
CGATATGTGGTAATTTGGATGA
>t0000005_x154782
AGAGGTAGTGATTCAAAAAGTT
>t0000006_x140076
TCACCGGGTAGACATTCATTATA
>t0000007_x131590
TGAGATCACTATGAAAGCTGG
>t0000008_x125368
TGAGGTAGAATGTTGGATGACT
>t0000009_x120455
TGAGTATTGCATCAAGAACCGA
>t0000010_x95804
TCCCTGAGACCATTGACTGCAT
>t0000011_x78210
TGGACGGAAGTGTAATGAGGGT
>t0000012_x73438
TGAGGTAGATTGTTGGATGACT
>t0000013_x68884
CCCGACCTCAGATCAGATG
>t0000014_x60358
TGAAAGACACAGGTAGTGGGACA
>t0000015_x59786
TGGAATGTCGAGAAATATGCAT
>t0000016_x44935
TCCCTGAGACCATTGACT
>t0000017_x40270
TCACCGGGTAGACATTCATTCT
>t0000018_x38439
AGATATGTTTGGTTAATTGGTGA
>t0000019_x38425
TGAGATCACTATGAAAGCTGGT
yueli is offline   Reply With Quote
Old 03-22-2015, 01:36 PM   #2
dpryan
Devon Ryan
 
Location: Freiburg, Germany

Join Date: Jul 2011
Posts: 3,480
Default

  1. Align the reads to the genome. Bowtie would be a likely candidate.
  2. Use bam2bed from bedops to convert the BAM file to BED format.

You might need to use samtools to convert from SAM to BAM, as I haven't a clue if bam2bed accepts SAM format. You can probably pipe all of this together too.
dpryan is offline   Reply With Quote
Old 03-22-2015, 04:52 PM   #3
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,975
Default

It is unusual to see fasta format raw data (if that is indeed original data).

Do the sequence ID's have any specific meaning (>t0000016_x44935)?
GenoMax is offline   Reply With Quote
Old 03-23-2015, 12:55 AM   #4
yueli
Member
 
Location: china

Join Date: May 2013
Posts: 71
Default

Hi, dpryan,

You are right!

I tried bedops to convert SAM to BED. How to use the convert2bed? I tried mant times, but it seems doesn't work.


Thanks a lot!

li



li@li-Lenovo:~$ convert2bed -i 1.sam > 1.bed
convert2bed
version: 2.4.12
author: Alex Reynolds

Usage:

$ convert2bed --input=fmt [--output=fmt] [options] < input > output
yueli is offline   Reply With Quote
Old 03-23-2015, 01:04 AM   #5
sarvidsson
Senior Member
 
Location: Berlin, Germany

Join Date: Jan 2015
Posts: 137
Default

Try
Code:
convert2bed -i SAM < 1.sam > 1.bed
sarvidsson is offline   Reply With Quote
Old 03-23-2015, 02:51 AM   #6
yueli
Member
 
Location: china

Join Date: May 2013
Posts: 71
Default

Thanks sarvidsson,

You are right!
yueli is offline   Reply With Quote
Old 03-25-2015, 11:22 AM   #7
AlexReynolds
Member
 
Location: Seattle, WA

Join Date: Feb 2013
Posts: 45
Default

As noted in another question, convenience wrapper scripts are provided to convert SAM and other formats to BED and Starch (compressed BED):

$ sam2bed < 1.sam > 1.bed
$ sam2starch < 1.sam > 1.starch

These are included with default BEDOPS installations.
AlexReynolds is offline   Reply With Quote
Reply

Tags
bed rna-seq

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 04:00 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO