SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
How to read frames in .gff file format redse171 General 7 02-29-2012 03:18 AM
Appending /1 or /2 to read identifiers (illumina 1.8+ format) Kennels Bioinformatics 3 10-24-2011 09:07 PM
read group in SAM format yinshe Bioinformatics 2 02-11-2011 04:14 AM
Short Read Archive format problems Ender985 Bioinformatics 7 07-28-2010 12:23 PM
Short Read Archive format dbrami Bioinformatics 2 04-28-2010 01:15 PM

Reply
 
Thread Tools
Old 07-08-2010, 10:35 AM   #1
kapoormanav
Junior Member
 
Location: St Louis

Join Date: Jul 2010
Posts: 9
Default New to next gen: read format help

Hi

I am new to next gen sequencing. I got my exome capture reads and I aligned it to ref genome using maq. Now someone told me that my reads are not in the sanger fastq format and when I tried to convert it with patch for maq the new file was empty.

Here is the example how my reads look like

HWI-EAS440_0346:6:1:1488:13263#0/1:ACCTCTAACAGCCTCATCGTCAGCTACATCTGGTTATATGCACTT
TATTTCAGCCATATCAACTTATTTAAGGCTT:Z]RXZJQKKZ_]Y]]Ja\[[]T`^Y\VHSV]^JZZ\_\``NYTVYYZ^
SNT_^^BBBBBBBBBBBBBBBBBBBBBB
HWI-EAS440_0346:6:1:1524:7965#0/1:CTGTTTGTTGTTTAACAAGCCTACCAGGTGATTCTGACTCACATTA
TAGTTTCAGCACAACTTTAAATTCTTTCTT:]]R_LUJTXH\]_aU\bb^bb`acaccbcc`\YaTc^cccccccc]]``
^Za_U\KL[WZ]U_LLTJT`K__aSZ\
HWI-EAS440_0346:6:1:1526:8854#0/1:GGAGCATGGGAACAAATGTTCTTGAAATATTCTGCCTATACTTTCA
AGTGGGATATGGATAATCACTGGCCAAGGG:][`T]ZZZU_b^bLLYY\L\aUUUUKZTT`LT]Yaa^cYY_YU_U``bL
`HWTRSZ__MY[HTYZZ[\Y^\L_`^`


Then I used one perl script which I got online and converted my reads to this format

@HWI-EAS440_0333_8_1_1016_4512#0/2
TTAGAGACTCCTGGATGCCCTGAGGGAGCGGCTCCAGAGCTTGCCTTCCCTCCTCTGTTTTCACAACGGTCCAGCG
+HWI-EAS440_0333_8_1_1016_4512#0/2
dd^e^d^dcd`ddadeeeeeeaYea`dccd\ddTdddYdbddd\d^ca_^L^`V^dYa`b`bc\Yb\Yba`TT`BB

and then another person from my lab told me that these quality scores do not match with sanger quality scores. Now I am totally confused that what I have? As no one else from lab has done next gen sequencing before so there is noone to help, and I am new to programming and sequencing I am also confused. Can someone help me regarding this?

Manav
kapoormanav is offline   Reply With Quote
Old 07-08-2010, 11:23 AM   #2
jmartin127
Member
 
Location: San Francisco

Join Date: Mar 2010
Posts: 15
Default

This may help to clarify things for you: http://en.wikipedia.org/wiki/FASTQ_format.
jmartin127 is offline   Reply With Quote
Old 07-08-2010, 01:09 PM   #3
kapoormanav
Junior Member
 
Location: St Louis

Join Date: Jul 2010
Posts: 9
Default

Thanks for the reply. Its helpful..
kapoormanav is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 10:35 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO