SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Why MAQ consensus seq better than SAMtools consensus ?? av_d Genomic Resequencing 5 10-18-2015 03:44 AM
Generate consensus sequence with Samtools mpileup? Heisman Bioinformatics 4 10-28-2013 04:57 PM
Problem calling consensus sequence with Samtools mpileup? Lspoor Bioinformatics 3 10-24-2011 07:43 AM
Consensus sequence nitinkumar Bioinformatics 0 05-21-2011 05:38 PM
Why are there all these As in my consensus sequence: An issue with samtools pileup dagarfield Bioinformatics 3 02-03-2011 10:14 AM

Reply
 
Thread Tools
Old 09-26-2011, 06:51 PM   #1
f0415007
Junior Member
 
Location: Shanghai

Join Date: Sep 2011
Posts: 4
Smile how to use samtools to get consensus sequence?

see #2

edited.

Last edited by f0415007; 09-26-2011 at 11:01 PM. Reason: explain
f0415007 is offline   Reply With Quote
Old 09-26-2011, 10:59 PM   #2
f0415007
Junior Member
 
Location: Shanghai

Join Date: Sep 2011
Posts: 4
Default

my command line:

samtools mpileup -uf [ref] [aln.bam] | /bcftools/bcftools view -cg - | /bcftools/vcfutils.pl vcf2fq > [result.fq]

the result shows :
@gi|110645304|ref|NC_002516.2|
GCGTCGGCCTGGGCAAGACCCACCTGATGCATGCGGTGGGCAACCACCTGCTGAAGAAGA
ACCCGAACGCCAAGGTGGTTTACCTGCATTCGGAACGTTTCGTCGCGGACATGGTGAAGG
+
....



i want to split the consensus seq to contigs at the point with 0-coverage. how may i determine the coverage of each base in the file?

and i dont want any ambiguous base, is that possible to play with parameters to achieve that? what does N or n mean in the sequence? is that gaps or 0-coverage?


thx for reply!
f0415007 is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 01:05 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO