So I was given a metatranscriptome prepped with the Nugen Ovation RNAseq kit.
The metatranscriptome was sequenced on a HiSeq 2000 paired end.
In the first read a lot of the sequences ~20% have the forward adapter at the end of the read - this is it's sequence:
GCTACGGGATGACTTGTGATTAGGGGTGAGAATGTCGGCCTGAGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGC
I'm just wondering what could cause this -
Here's an example read with the adapter in it. If anything shouldn't it be at the front of the read? Why would it be at the end and why is there still more sequence after it?
GCTACGGGATGACTTGTGATTAGGGGTGAGAATGTCGGCCTGAGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGC
Thanks
The metatranscriptome was sequenced on a HiSeq 2000 paired end.
In the first read a lot of the sequences ~20% have the forward adapter at the end of the read - this is it's sequence:
GCTACGGGATGACTTGTGATTAGGGGTGAGAATGTCGGCCTGAGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGC
I'm just wondering what could cause this -
Here's an example read with the adapter in it. If anything shouldn't it be at the front of the read? Why would it be at the end and why is there still more sequence after it?
GCTACGGGATGACTTGTGATTAGGGGTGAGAATGTCGGCCTGAGAGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGC
Thanks
Comment