SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
how to order the reads of DNA methylation data from bisulfite sequencing Jim Michael Bioinformatics 7 10-24-2012 05:40 AM
P1 adaptor vs. Multiplex P1 adaptor hfaoro SOLiD 0 03-26-2012 05:54 AM
How to trim the adaptor sequence from the solexa small RNA sequencing data? satp Bioinformatics 11 11-17-2010 01:08 PM
How can I determine order of scaffolds from de novo sequencing? odysseus Bioinformatics 0 03-21-2010 08:05 PM
How can I determine order of scaffolds from de novo sequencing? odysseus Introductions 0 03-21-2010 04:45 AM

Reply
 
Thread Tools
Old 04-23-2013, 06:43 AM   #1
Sakti
Junior Member
 
Location: NY

Join Date: May 2011
Posts: 6
Default Adaptor order in PE sequencing

Dear all,

This might be a stupid question, but it's better asking than wasting a whole lane of HiSeq (and my PI hating me for the rest of my degree ).

I have different regions I'd like to amplify using PCR with primers that already have ligated Illumina PE adaptors to them, as in the following scheme:

Forward primer: [P1adaptor][forward.primer.sequence]
Reverse primer: [P2adaptor][reverse.primer.sequence]

So the PCR product would look something like:

[P1adaptor][forward.primer.sequence]XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX
XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX[reverse.primer.sequence][P2adaptor]


My question is, would it matter if I swap the order of adaptors so that instead of forward primer having PE1 adaptor it has PE2??

Like this:

Reverse primer: [P1adaptor][reverse.primer.sequence]
Forward primer: [P2adaptor][forward.primer.sequence]

I think it shouldn't alter anything, just basically the order in which the primer sequence is reported (reverse primer now being reported in the 1st PE reads rather than the 2nd reads).

Thanks!!!

Last edited by Sakti; 04-23-2013 at 09:43 AM.
Sakti is offline   Reply With Quote
Old 04-23-2013, 09:21 AM   #2
kcchan
Senior Member
 
Location: USA

Join Date: Jul 2012
Posts: 184
Default

Just to clarify, are you trying to swap just the PCR primer or the sequencing primer? If you choose to swap one you'll have to swap the other or your primers will be in the wrong direction.
kcchan is offline   Reply With Quote
Old 04-23-2013, 09:31 AM   #3
Sakti
Junior Member
 
Location: NY

Join Date: May 2011
Posts: 6
Default

Quote:
Originally Posted by kcchan View Post
Just to clarify, are you trying to swap just the PCR primer or the sequencing primer? If you choose to swap one you'll have to swap the other or your primers will be in the wrong direction.
Good point, I'm just swaping the sequencing primer (either P1 or P2), not the primer that binds and amplifies the sequence.

i.e

forward primer: ATGAGGGTCCAATCCATAAGC
rev primer: AGAGACATCGGTCTCTGATGGT

With adaptors:

for with P1:
AATGATA...CGCTCTTCCGATCTATGAGGGTCCAATCCATAAGC

rev with P2:
CAAGCAG...CTCTTCCGATCTAGAGACATCGGTCTCTGATGGT


What I want to do is:

for with P2:
CAAGCAG...CTCTTCCGATCTATGAGGGTCCAATCCATAAGC

rev with P1:
AATGATA...CGCTCTTCCGATCTAGAGACATCGGTCTCTGATGGT

I want to know if that alters the PCR reaction itself (i.e. primers going outwards instead of amplifying into the region I want)

Last edited by Sakti; 04-23-2013 at 09:54 AM.
Sakti is offline   Reply With Quote
Old 04-23-2013, 09:44 AM   #4
kcchan
Senior Member
 
Location: USA

Join Date: Jul 2012
Posts: 184
Default

Your primers aren't going outwards. All you're doing is flipping the amplicon upside down so that read 1 becomes read 2 and vice versa.
kcchan is offline   Reply With Quote
Old 04-23-2013, 09:54 AM   #5
Sakti
Junior Member
 
Location: NY

Join Date: May 2011
Posts: 6
Default

Quote:
Originally Posted by kcchan View Post
Your primers aren't going outwards. All you're doing is flipping the amplicon upside down so that read 1 becomes read 2 and vice versa.
Thank you very much
Sakti is offline   Reply With Quote
Reply

Tags
illumina

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:37 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO