Illumina/Solexa Genome Analyzer Primer/Adapter Sequences - Page 2

hilahg · 03-11-2009, 07:12 AM

Hi all,
I have a question:
I've prepared a cDNA library for solexa (double stranded) with 5' end after enzymatic cleavage by MMEI (see below). I would like to perform a single read from 5' (the left side with the MME sticky end). GEX2 adapter fits this site. My question is which adapter do I need for the 3' side to perform a single read of the 5' side (left side)?

5'_________? 3'
adapter Gex 2 3'___________
(MMEI side) which adapter on this side?

Can anyone answer this???

hilahg · 03-11-2009, 07:13 AM

the figure came out wrong... I hope you can still understand my question above....

sci_guy · 03-11-2009, 03:44 PM

Do pages 17 - 20 of this help?

hilahg · 03-12-2009, 02:06 PM

yes it helps, thank you

greigite · 03-31-2009, 10:55 AM

Perhaps the sequences are shown in Figure 2 and table S3 of this paper by Craig et al (http://www.nature.com/nmeth/journal/...th.1251.html)? I notice one of the authors has an Illumina affiliation and the paper describes 6 bp error corrected tags. Of course, they don't tell you outright which ones are the best but my guess is the 13 tags showing less than 2-fold difference in index frequencies between runs (Fig 2).

Quote:

Originally Posted by breakt1000

Hi,

Has anyone got the multiplex oligo sequences that Illumina use in their Multiplex (12-plex) kits? (And their concentrations if they're known.)

greigite · 04-06-2009, 02:15 PM

Hi all
I put together a comparison of SR and PE sequences to get a quick look at regions of sequence similarity. Thought it might be useful for others (let me know if you spot errors). As far as I can tell, the SR and PE read 1 sequencing primers are identical, as are the SR and PE adapters with the T overhang. Seems to me that given this, it should be fine to run a PE library on an SR flowcell using SR reagents. Comments?
All the sequences are from the Bentley et al. nature paper supplementary info last year.

wangdaowen · 05-31-2009, 01:31 AM

yes it help,thank

wangdaowen · 05-31-2009, 01:32 AM

thank,
Has anyone got the multiplex oligo sequences that Illumina use in their Multiplex (12-plex) kits? (And their concentrations if they're known.)

kwatkins · 06-23-2009, 10:51 AM

Hi!
I am trying to add adapters onto a cDNA pool by PCR. Has anyone done this before? I not sure how to design and orient my primers. I am currently looking to use the adapters for "Genomic DNA oligonucleotide sequences"
Thanks!
Kate

jrelmore · 07-22-2009, 05:39 PM

Does anyone happen to know the concentrations of the PR 5' adapter and the 10x v1.5 sRNA 3' adapter in the small RNA cloning kits?

jrelmore · 07-23-2009, 06:58 PM

I know a few people other than myself were looking for the concentrations of the Solexa v1.5 kit (and well all of them in my case) adapters. I spoke with a tech support person from Illumina and they told me the concentrations of the stock solutions before any of the dilutions were as such:

3' sRNA Adapter v1.5 = 5µM
SRA 5' Adapter = 5µM

Other oligos:

SRA RT primer = 100µM
Primer GX1/2 = 25µM

Hope that helps!

-Joshua

frozenlyse · 08-19-2009, 01:30 AM

Hi - I am a bit confused about the Illumina Paired end adaptors..

Are they a Y adaptor (illustrated below) where you have 2 primers which are complementary at the end you ligate to your library (ie i should only synthesise 2 oligos)

Code:

5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3'
                      |||||||||||||
3'-GAGCCGTAAGGACGACTTGGCGAGAAGGCTAG-PO4-3'

or are they two sets of fully complementary primers, so i should order 4 oligos? this is what it seems to illustrate in post #7

Code:

5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3'
   ||||||||||||||||||||||||||||||||
3'-TGTGAGAAAGGGATGTGCTGCGAGAAGGCTAG-PO4-5'
and
5'-PO4-GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG-3'
       ||||||||||||||||||||||||||||||||
   3'-TCTAGCCTTCTCGCCAAGTCGTCCTTACGGCTC-5'

Cheers!

hilahg · 08-19-2009, 03:54 AM

Hi all,
thank you for all the replies. It was very helpful.
I have another question regarding MME cleavage. I use this protocol for library preparation(with MMEI cleavage): http://keck.med.yale.edu/microarrays...04241_RevA.pdf

I'm experiencing trouble with the MME cutting procedure as it doesnt! cleave. Has anyone experienced this problem in the library preparation process. I use MME from NEB
and tried various concentrations but without improvement...

Thanks,

Hilah

kmcarr · 08-19-2009, 06:49 AM

frozenlyse,

You would only synthesize the two oligos as in your first figure. Look at this thread http://seqanswers.com/forums/showthread.php?t=1169 (in particular the PDF attachment)

der_eiskern · 08-21-2009, 05:42 PM

so it's friday evening, and i was supposed to be amplifying my library before going home tonight however my coworker used all of our amplifying PCR Primers 2.1 and 1.1 for SE sequencing and I can't find an accurately labeled figure of the sequences for these SE PCR primers that Illumina sends out. I'm finding PE sequences everywhere though.

clarification?

Thanks.

Quote:

Originally Posted by ECO

Sequences for Solexa Library Preparations:

Genomic DNA oligonucleotide sequences

Adapters 1
5' P-GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG
5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT

PCR Primers 1
5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
5' CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT

Genomic DNA Sequencing Primer
5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT

DpnII gene expression oligonucleotide sequences

Gex Adapter 1
5' P-GATCGTCGGACTGTAGAACTCTGAAC
5’ ACAGGTTCAGAGTTCTACAGTCCGAC

Gex Adapter 2
5' CAAGCAGAAGACGGCATACGANN
5' P-TCGTATGCCGTCTTCTGCTTG

Gex PCR Primer 1
5' CAAGCAGAAGACGGCATACGA

Gex PCR Primer 2
5' AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA

Gex Sequencing Primer
5' CGACAGGTTCAGAGTTCTACAGTCCGACGATC

NlaIII gene expression oligonucleotide sequences

Gex Adapter 1
5' P-TCGGACTGTAGAACTCTGAAC
5' ACAGGTTCAGAGTTCTACAGTCCGACATG

Gex Adapter 2
5' CAAGCAGAAGACGGCATACGANN
5' P-TCGTATGCCGTCTTCTGCTTG

Gex PCR Primer 1
5' CAAGCAGAAGACGGCATACGA

Gex PCR Primer 2
5' AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA

Gex Sequencing Primer
5' CCGACAGGTTCAGAGTTCTACAGTCCGACATG

Small RNA oligonucleotide sequences

RT Primer
5' CAAGCAGAAGACGGCATACGA

5' RNA Adapter
5' GUUCAGAGUUCUACAGUCCGACGAUC

3' RNA Adapter
5' P-UCGUAUGCCGUCUUCUGCUUGUidT

Small RNA PCR Primer 1
5' CAAGCAGAAGACGGCATACGA

Small RNA PCR Primer 2
5' AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA

Small RNA Sequencing Primer
5' CGACAGGTTCAGAGTTCTACAGTCCGACGATC

**disclaimer blah blah blah. We take no responsibility if you blow a flow cell using these sequences!

greigite · 08-21-2009, 06:01 PM

You can get the SE and PE PCR primer sequences from the supplementary info of Bentley et al 2009 (http://www.ncbi.nlm.nih.gov/pubmed/18987734). I pulled these and did a comparison of PE and SE primers/adapters (p 9 of attached pdf).

Quote:

Originally Posted by der_eiskern

so it's friday evening, and i was supposed to be amplifying my library before going home tonight however my coworker used all of our amplifying PCR Primers 2.1 and 1.1 for SE sequencing and I can't find an accurately labeled figure of the sequences for these SE PCR primers that Illumina sends out. I'm finding PE sequences everywhere though.

clarification?

Thanks.

der_eiskern · 08-21-2009, 06:22 PM

thanks greigite!

tgdeering · 09-09-2009, 02:30 PM

I am looking into making my own SE primers and noticed in the Bentley et al 2009 paper that they used phosphorothioate modified primers. Does anyone else who uses their own primers do this? Also, what purification for the oligos is needed? Standard desalting, PAGE, etc?

der_eiskern · 09-09-2009, 02:36 PM

i just got HPLC purified phosphorothioate primers today in the post. I'll try to post how happy i am with them.

i've run into problems after gel purifying the ligated adaptors with inefficient amplification, hopefully this helps...

we'll see.

der_eiskern · 09-09-2009, 05:48 PM

tgdeering, phosphorothioate fixed my problems. before i could barely see a band after amplification but with phosphorothioate primers i got maximal amplification with iProof.

Similar Threads
Thread	Thread Starter	Forum	Replies	Last Post
trim adapter from Illumina Genome Analyzer IIe miRNA reads	NicoBxl	Bioinformatics	5	01-02-2014 06:31 AM
Illumina Adapter and Primer preparation	S.Iyengar	Sample Prep / Library Generation	7	11-04-2013 08:08 AM
primer/adapter sequences	nikiwilson	Sample Prep / Library Generation	2	06-21-2011 02:36 PM
what's the different between Illumina Genome Analyzer	biocc	Illumina/Solexa	3	06-04-2010 12:28 AM
A clarification for Illumina/Solexa Genome Analyzer Primer/Adapter Sequences	kaichen	Illumina/Solexa	1	08-06-2009 06:57 PM

03-11-2009, 07:12 AM	#21
hilahg Junior Member Location: asia Join Date: Mar 2009 Posts: 4	which adapters to use Hi all, I have a question: I've prepared a cDNA library for solexa (double stranded) with 5' end after enzymatic cleavage by MMEI (see below). I would like to perform a single read from 5' (the left side with the MME sticky end). GEX2 adapter fits this site. My question is which adapter do I need for the 3' side to perform a single read of the 5' side (left side)? 5'_________? 3' adapter Gex 2 3'___________ (MMEI side) which adapter on this side? Can anyone answer this???

05-31-2009, 01:31 AM	#27
wangdaowen Junior Member Location: china Join Date: May 2009 Posts: 2	thank yes it help,thank

08-19-2009, 01:30 AM	#32
frozenlyse Senior Member Location: Australia Join Date: Sep 2008 Posts: 136	Hi - I am a bit confused about the Illumina Paired end adaptors.. Are they a Y adaptor (illustrated below) where you have 2 primers which are complementary at the end you ligate to your library (ie i should only synthesise 2 oligos) Code: 5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3' \|\|\|\|\|\|\|\|\|\|\|\|\| 3'-GAGCCGTAAGGACGACTTGGCGAGAAGGCTAG-PO4-3' or are they two sets of fully complementary primers, so i should order 4 oligos? this is what it seems to illustrate in post #7 Code: 5'-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3' \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| 3'-TGTGAGAAAGGGATGTGCTGCGAGAAGGCTAG-PO4-5' and 5'-PO4-GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG-3' \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\| 3'-TCTAGCCTTCTCGCCAAGTCGTCCTTACGGCTC-5' Cheers!

03-11-2009, 07:13 AM	#22
hilahg Junior Member Location: asia Join Date: Mar 2009 Posts: 4	the figure came out wrong... I hope you can still understand my question above....

03-11-2009, 03:44 PM	#23
sci_guy Member Location: Sydney, Australia Join Date: Jan 2008 Posts: 83	Do pages 17 - 20 of this help?

03-12-2009, 02:06 PM	#24
hilahg Junior Member Location: asia Join Date: Mar 2009 Posts: 4	yes it helps, thank you

05-31-2009, 01:32 AM	#28
wangdaowen Junior Member Location: china Join Date: May 2009 Posts: 2	thank, Has anyone got the multiplex oligo sequences that Illumina use in their Multiplex (12-plex) kits? (And their concentrations if they're known.)

06-23-2009, 10:51 AM	#29
kwatkins Junior Member Location: Providence, RI Join Date: Jun 2009 Posts: 1	Hi! I am trying to add adapters onto a cDNA pool by PCR. Has anyone done this before? I not sure how to design and orient my primers. I am currently looking to use the adapters for "Genomic DNA oligonucleotide sequences" Thanks! Kate

07-22-2009, 05:39 PM	#30
jrelmore Junior Member Location: Athens, GA Join Date: Jul 2009 Posts: 2	Does anyone happen to know the concentrations of the PR 5' adapter and the 10x v1.5 sRNA 3' adapter in the small RNA cloning kits?

07-23-2009, 06:58 PM	#31
jrelmore Junior Member Location: Athens, GA Join Date: Jul 2009 Posts: 2	I know a few people other than myself were looking for the concentrations of the Solexa v1.5 kit (and well all of them in my case) adapters. I spoke with a tech support person from Illumina and they told me the concentrations of the stock solutions before any of the dilutions were as such: 3' sRNA Adapter v1.5 = 5µM SRA 5' Adapter = 5µM Other oligos: SRA RT primer = 100µM Primer GX1/2 = 25µM Hope that helps! -Joshua

08-19-2009, 03:54 AM	#33
hilahg Junior Member Location: asia Join Date: Mar 2009 Posts: 4	Hi all, thank you for all the replies. It was very helpful. I have another question regarding MME cleavage. I use this protocol for library preparation(with MMEI cleavage): http://keck.med.yale.edu/microarrays...04241_RevA.pdf I'm experiencing trouble with the MME cutting procedure as it doesnt! cleave. Has anyone experienced this problem in the library preparation process. I use MME from NEB and tried various concentrations but without improvement... Thanks, Hilah

08-19-2009, 06:49 AM	#34
kmcarr Senior Member Location: USA, Midwest Join Date: May 2008 Posts: 1,155	frozenlyse, You would only synthesize the two oligos as in your first figure. Look at this thread http://seqanswers.com/forums/showthread.php?t=1169 (in particular the PDF attachment)

08-21-2009, 06:22 PM	#37
der_eiskern Member Location: California Join Date: Jul 2009 Posts: 46	thanks greigite!

09-09-2009, 02:30 PM	#38
tgdeering Junior Member Location: Texas Join Date: Mar 2009 Posts: 1	I am looking into making my own SE primers and noticed in the Bentley et al 2009 paper that they used phosphorothioate modified primers. Does anyone else who uses their own primers do this? Also, what purification for the oligos is needed? Standard desalting, PAGE, etc?

09-09-2009, 02:36 PM	#39
der_eiskern Member Location: California Join Date: Jul 2009 Posts: 46	i just got HPLC purified phosphorothioate primers today in the post. I'll try to post how happy i am with them. i've run into problems after gel purifying the ligated adaptors with inefficient amplification, hopefully this helps... we'll see.

09-09-2009, 05:48 PM	#40
der_eiskern Member Location: California Join Date: Jul 2009 Posts: 46	tgdeering, phosphorothioate fixed my problems. before i could barely see a band after amplification but with phosphorothioate primers i got maximal amplification with iProof.