SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
Custom TruSight Sequencing Primers ibuyufo Illumina/Solexa 0 01-24-2017 10:33 AM
custom sequencing primers on HiSeq3000 beetle_doc Illumina/Solexa 2 11-08-2016 02:18 PM
Index sequencing primer for use with custom primers (16S metagenomic) amango Illumina/Solexa 1 02-24-2016 10:10 AM
Using MiSeq with both standard and custom sequencing/index primers at the same time? kevin_bryant Illumina/Solexa 1 02-27-2014 12:57 PM
custom sequencing primers athos Illumina/Solexa 5 02-04-2011 10:47 AM

Reply
 
Thread Tools
Old 01-11-2018, 01:34 AM   #1
abbecker
Junior Member
 
Location: .........

Join Date: Jan 2018
Posts: 2
Default Custom Sequencing Primers

Hello,
are there any Illumina sequencing read primers that differ in thier last 13 bp?

Would

Read1 (from TruSeq):
ACACTCTTTCCCTACACGACGCTCTTCCGATCT
Read 2 (from Nextera Transposase Adapters):
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG

work?

I am using a two step PCR (without ligation) to make the library, so I am really flexible in what read primers I can use.
PCR1: universal_primer+target_specific_primer
PCR2: Illumina_adapter+index+pad+universal_primer
read primer: pad+universal_primer

Last edited by abbecker; 01-11-2018 at 01:45 AM.
abbecker is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 08:29 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO