SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Kmer frequency runnerBio88 Bioinformatics 2 10-31-2015 04:58 PM
Estimating heterozygosity from kmer frequency distribution MeganS Bioinformatics 4 09-03-2015 09:15 AM
Estimating the bacterial genome size using Kmer frequency Krish_143 Bioinformatics 3 06-02-2013 02:13 PM
Allele frequency calculation in SNP calling Rachelly Bioinformatics 5 05-14-2012 11:07 AM
Variant Frequency Calculation (non-SNP)? dmtruong Bioinformatics 0 12-27-2011 05:53 PM

Reply
 
Thread Tools
Old 12-01-2015, 02:20 PM   #1
arif.at.iut
Junior Member
 
Location: Virginia, USA

Join Date: Dec 2015
Posts: 2
Default Sequence read (id) specific kmer frequency calculation

Hi,

How to count sequence read specific kmers from a single fasta file? I am working on Ulcerative Colitis Human Gut Microbiome data, where I have separate fasta files for separate patients. Each fasta contains a huge number of sequence reads with respective ids. I want to know the kmer counts for each sequence reads separately with their respective sequence IDs. Is there any software for that? Custom program takes too much time. Any help will be appreciated.
arif.at.iut is offline   Reply With Quote
Old 12-01-2015, 04:39 PM   #2
Brian Bushnell
Super Moderator
 
Location: Walnut Creek, CA

Join Date: Jan 2014
Posts: 2,707
Default

I might have a tool that can do this, but I'd need a little more details... can you give an example of a few lines of the output you want?
Brian Bushnell is offline   Reply With Quote
Old 12-01-2015, 06:19 PM   #3
arif.at.iut
Junior Member
 
Location: Virginia, USA

Join Date: Dec 2015
Posts: 2
Default

Hi, Here is a part of FASTA file containing metagenomic data:

>SRR579292.1.1 1 length=151
NAAAGAGTATGATGCAGTGTTAATTACCATTGGAGCAAGTACGGATAAAAAACTGGGCTTGGAAGGAGAGGATGCAGAAGGGATCTTTTCGGCAGTGCAGTTTTTAAGAAATGTAGGTCAGAATATCATCATGGATCTGACAGGGAAAGAA
>SRR579292.1.2 1 length=151
NAACATTACCGCCTCCGATTACCGCAACTTCTTTCCCTGTCAGATCCATGATGATATTCTGACCTACATTTCTTAAAAACTGCACTGCCGAAAAGATCCCTT

Now in output I want to know the kmers in SRR579292.1.1 1 and kmers in SRR579292.1.2 1 separately. Is it possible with any tool/software? Stuck here hopelessly
arif.at.iut is offline   Reply With Quote
Old 12-02-2015, 10:03 AM   #4
Brian Bushnell
Super Moderator
 
Location: Walnut Creek, CA

Join Date: Jan 2014
Posts: 2,707
Default

Well... the BBMap package does contain a program that will do this, "commonkmers.sh". For example:

commonkmers.sh in=reads.fq out=kmers.txt k=4 count=t display=999

That will produce output that looks like this:
Code:
MISEQ05:239:000000000-A74HF:1:2110:14788:23085	ATGA=8	ATGC=6	GTCA=6	AAAT=5	AAGC=5	AATG=5	AGCA=5	ATAA=5	ATTA=5	CAAA=5	CATA=5	CATC=5	CTGC=5	AACC=4	AACG=4	AAGA=4	ACAT=4	ACCA=4	AGAA=4	ATCA=4	ATGG=4	CAAG=4	CCAA=4	CCTC=4	CTCA=4	CTGA=4	CTTC=4	GAGC=4	GGTA=4	GTAA=4	GTTA=4	AAAA=3	AAAC=3	AAGT=3	ACCG=3	ACGG=3	ACTG=3	AGAT=3	AGCT=3	AGGA=3	AGTA=3	AGTC=3	CAGC=3	CATG=3	CGAG=3	CGGA=3	CGTC=3	CTAA=3	CTCC=3	CTTA=3	GAAA=3	GACA=3	GACC=3	GAGA=3	GCAA=3	GGAC=3	TCAA=3	TGCA=3	AAAG=2	AACA=2	AATA=2	AATC=2	ACAA=2	ACCC=2	ACCT=2	ACGA=2	ACGC=2	AGAC=2	AGCG=2	AGGC=2	CAAC=2	CAGG=2	CCGC=2	GCCA=2	GCTA=2	GGAA=2	GGCA=2	TAAA=2	TAGA=2	TCCA=2	TGAA=2	AAGG=1	AATT=1	ACGT=1	AGAG=1	AGCC=1	AGGG=1	ATAC=1	ATAG=1	ATTG=1	CACA=1	CACG=1	CAGA=1	CCAC=1	CCCA=1	CCGA=1	CCTA=1	CGAC=1	CGCA=1	CGCC=1	CGCG=1	CGTA=1	CTAC=1	GAAC=1	GCGA=1	GCGC=1	GTAC=1	GTGA=1	TTAA=1
Brian Bushnell is offline   Reply With Quote
Old 12-02-2015, 12:58 PM   #5
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 7,049
Default

@arif.at.iut: How are you planning to use the k-mer information Brian's program will generate?
GenoMax is offline   Reply With Quote
Reply

Tags
fasta, kmers, metagenome, read, sequence

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 06:07 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO