SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
Miseq custom primer design, primer linker Cyrus Taheri Illumina/Solexa 1 04-21-2015 05:25 PM
What happens if a custom read 2 sequencing primer fails? bilyl Illumina/Solexa 5 05-29-2014 03:15 PM
CLC paired read orientation- max. and min. read distance gevielr Bioinformatics 1 11-10-2013 02:56 PM
50+% of my HiSEQ reads are 3' primer (custom primer used) ZAAB Sample Prep / Library Generation 3 02-06-2012 11:00 AM
custom primer menglv Illumina/Solexa 3 01-18-2011 01:01 PM

Reply
 
Thread Tools
Old 07-05-2016, 10:50 AM   #1
rgejman
Junior Member
 
Location: New York

Join Date: Nov 2010
Posts: 4
Default Distance between P5 and custom read 1 primer

Dear all,

I have a minigene library which is amplified with P5/P7 sites that looks like this

[P7/barcode][constant region][ variable region ][18nt constant region][SP1][P5] (436nt total)

We sequenced this library using the standard Illumina read 1 primers @ low cluster density (~600k) + 25% PhiX. Unfortunately, only a small fraction of clusters passed filter because of the low sequence diversity. Before we redesign the library, we are considering using a custom primer to sequence over the constant region:

5' ACGCTCTTCCGATCTTTGGCCTGTTTGGCCTTA 3'

This custom primer is 33nt, 52% GC, Tm ~ 66ēC. It binds to the complete constant region along with half of SP1 (bolded). The first nucleotide after the primer is the first base of the variable region. It will be tested by PCR to make sure it amplifies from the amplicon.

Before we use it for sequencing, I wanted to know if anyone had any experience sequencing with a custom primer that does not immediately abut the P5 hybridization site. I assume this should be OK, but wanted to get other people's opinion on this and any other issue I should consider first. For instance, are there any modifications that should be included when ordering this primer (other than HPLC purification).

Many thanks!

Ron

Last edited by rgejman; 07-05-2016 at 10:54 AM.
rgejman is offline   Reply With Quote
Old 07-19-2016, 07:02 AM   #2
DStephens@NuGEN
Registered Vendor
 
Location: SF Bay Area

Join Date: Jun 2016
Posts: 3
Default

Hi rgejman,
Our Ovation SoLo RNA-Seq System uses a custom primer to overcome low-diversity sequence at the 5’ end of the library. Like your custom primer, there is overlap with the SP1 sequence and it does not abut the P5 hybridization sequence. We do not have any issues with sequencing libraries from this kit when the entire flow cell contains libraries from the kit. One issue to consider is that, due to the overlap in primer sequence, the custom primer cannot be mixed with the standard Illumina read 1 primer. This means that the entire flow cell must use the custom primer, which can be expensive depending on your experiment. Alternatively, we have found that we can use the standard primer successfully as long as the flow cell does not contain more than 60% of libraries from the SoLo kit. You might want to consider re-sequencing your libraries using the Illumina standard read 1 primer with a higher % of multiplexing from other libraries.

Hope that helps!
__________________
Denise Stephens
Technical Support Scientist at NuGEN Technologies
DStephens@NuGEN is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 10:57 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO