SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Trimmomatic adapter file error Batstaph Bioinformatics 9 12-18-2017 08:18 AM
Trimmomatic adapter file vs Custom made file candida Bioinformatics 1 05-03-2017 03:07 AM
How to correct wrong adapter splitting in PacBio films? cklopp Pacific Biosciences 3 03-04-2016 08:34 AM
Trimmomatic RNAseq Adapter Cut arcolombo698 RNA Sequencing 2 12-05-2013 01:58 AM
Remove the adapter sequence by fastx_clipper in fastq file Jiafen Bioinformatics 14 08-08-2013 01:16 AM

Reply
 
Thread Tools
Old 04-11-2018, 07:02 PM   #1
gbatzel
Junior Member
 
Location: earth

Join Date: Apr 2018
Posts: 1
Default Correct Trimmomatic adapter sequence file to use?

Hi,

I was told by the sequencing core that my mRNA libraries were prepared with the TruSeq Dual index adapter. They gave me two different sequences:

Index 1 (i7) Adapters GATCGGAAGAGCACACGTCTGAACTCCAGTCAC[i7]ATCTCGTATGCCGTCTTCTGCTTG

Index 2 (i 5) Adapters AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACGCTCTTCCGATCT

I was wondering which Trimmomatic adapter .fasta file to use?
gbatzel is offline   Reply With Quote
Old 04-12-2018, 03:40 AM   #2
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 6,703
Default

Use TruSeq3-PE.fa file.
GenoMax is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 12:53 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO