SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
NEw to Chip-seq and have .bam/.sam/.bam.bai files... then what? NGS newbie Bioinformatics 11 05-25-2011 07:48 AM
Generate subset from BAM format ForeignMan Genomic Resequencing 4 02-28-2011 06:20 AM
the tophat generate the bam file instead of sam files? dingkai0564 Bioinformatics 1 11-10-2010 07:33 PM
problem with gsnap sam output lindseyjane Bioinformatics 2 11-04-2010 04:27 AM
Getting pileup consensus from BAM files using Bio::DB::Sam ragowthaman Bioinformatics 2 08-03-2010 08:21 AM

Reply
 
Thread Tools
Old 10-15-2011, 06:24 AM   #1
efoss
Member
 
Location: Seattle

Join Date: Jul 2011
Posts: 98
Default Can GSNAP generate SAM/BAM files?

I am running gsnap with this command:

gsnap --gunzip -d Drosophila5 -D /home/efoss/gene_databases/GMAP_GSNAP_db/ D09NJACXX_s8_1_illumina12index_8_SL7777.fastq.gz D09NJACXX_s8_2_illumina12index_8_SL7777.fastq.gz > D09NJACXX_s8_illumina12index_8_SL7777.sam

The output clearly is not in standard sam format. Is it possible to generate standard sam/bam files with gsnap, and if so, how?

Thank you.

Eric
efoss is offline   Reply With Quote
Old 10-15-2011, 07:22 AM   #2
cedance
Senior Member
 
Location: Germany

Join Date: Feb 2011
Posts: 108
Default

Are specific columns missing? or certain columns are 0? what's the problem you see?
cedance is offline   Reply With Quote
Old 10-15-2011, 07:46 AM   #3
efoss
Member
 
Location: Seattle

Join Date: Jul 2011
Posts: 98
Default

Hi cedance,

I see output like this:


>CNAANATATATTGCACCATCCGCCGATCCGCAGGCAATTTTTAGGCCATT 0 unpaired <#0<#28899;<>><<?=<?>?@<==49=?;===?>1:;9:>>??;>??< HWI-ST156:39709NJACXX:8:1101:1790:1988

<ATCACAAACGAACACTTTAAAATCAGCTGTGATTTTGCTCGGGCTTCCTT 0 unpaired F?@@DFDDDDF;1C;BBDAEGCBFHJI<CGEIJEIEBF?D)6D@?FDHB= HWI-ST156:39709NJACXX:8:1101:1790:1988

>TNGANCTGGACCAGGTAATGGGATATACTGTTGTCCGGCGCCTGTTCAGC 0 unpaired 3#0:#2288>>?@@<@=??=<7:>9>>9@?@??>>9=88=?8?<1=???? HWI-ST156:39709NJACXX:8:1101:1980:1992

<AAAAACACTCACACCAAACATCAGCAGGATGCTGCAGCCCCCGGATGAGA 0 unpaired F<@<D+ADDDFF3??EDG?:CF?F<@;F811899?@C<@FG>AA'B;==E HWI-ST156:39709NJACXX:8:1101:1980:1992

>CTGANACTCGGGATCTGCACGGCGATAGCGGGCACCCAGGCTGGAGATGA 0 unpaired @?@F#2=BCDAA?FHIGCHIGIIIBEEGEHGGBACHEDFBCCCBABC>>> HWI-ST156:39709NJACXX:8:1101:1775:1997

This doesn't match the mandatory fields for a sam file:

http://samtools.sourceforge.net/SAM1.pdf

Thank you for the help.

Eric
efoss is offline   Reply With Quote
Old 10-15-2011, 08:02 AM   #4
cedance
Senior Member
 
Location: Germany

Join Date: Feb 2011
Posts: 108
Default

I remember vaguely but there is a --format=sam parameter to specifically output the results in SAM format. You should check out the parameter list and add it to your command line options accordingly.
cedance is offline   Reply With Quote
Old 10-16-2011, 08:11 PM   #5
efoss
Member
 
Location: Seattle

Join Date: Jul 2011
Posts: 98
Default

Quote:
Originally Posted by cedance View Post
I remember vaguely but there is a --format=sam parameter to specifically output the results in SAM format. You should check out the parameter list and add it to your command line options accordingly.
Thanks so much, cedance. I see that that is one of my critical mistakes. I thought I had read through the options carefully, but I guess I hadn't read them carefully enough. I very much appreciate the help.

Best wishes,

Eric
efoss is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 10:04 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO