SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
SNP coverage using Pile up From RSamtools MAPK Bioinformatics 0 11-05-2015 11:42 PM
how to calculate base-by-base coverage? shuoguo Bioinformatics 4 02-21-2014 08:06 PM
base coverage per position on scaffolds boetsie Bioinformatics 5 01-23-2014 05:44 AM
*** Per base coverage *** cristae8 Bioinformatics 5 07-21-2011 05:11 PM
Base coverage from Bam ElMichael Bioinformatics 4 12-01-2010 10:18 AM

Reply
 
Thread Tools
Old 09-06-2017, 07:56 AM   #1
heso
Member
 
Location: Sweden

Join Date: May 2014
Posts: 19
Default How to pile up reads and get per base coverage?

Hi,

I have list of sequences (17-35bases) with sequence read count in column 1.
I would like to see the end processing patterns of these sequences (to pile up similar ones and get the per-base coverage).

E.g. two sequences in my input file:
Code:
      4 TTGATCCTTCGATGTCGGCTCTTCCT
    30 ATCCTTCGATGTCGGCTCTTCCTATCATT
alignment of these sequences would look like that:
Code:
 TTGATCCTTCGATGTCGGCTCTTCCT
    ATCCTTCGATGTCGGCTCTTCCTATCAT
So the coverage of the first 3 nucleotides (TTG) is read count=4, for ATCCTTCGATGTCGGCTCTTCCT its 30+4=34 and for ATCAT it's 30


In principle, the end result/graph should look like this one here:
http://www.frontiersin.org/files/Art...00145-g003.jpg


I know bedtools can output genomic coverage, but I'm afraid it won't be useful here...Does anybody have an idea how to solve this? I also have .sam files containing the same sequences, if that's of any help...


Thanks in advance

Last edited by GenoMax; 09-06-2017 at 08:52 AM.
heso is offline   Reply With Quote
Old 09-07-2017, 12:43 PM   #2
aprice67
Member
 
Location: New York

Join Date: Nov 2012
Posts: 49
Default

Hi,

I have a script that does that from my PhD days. I actually used this for some RNA secondary structure projects, so it looks like you're working on something similar.

https://github.com/price0416/scripts...llbam2depth.py

Disclaimer: I wrote this like 4 years ago and don't remember exactly all the details of it, so be sure to examine the code for yourself, it's not very long.

Hope this helps!

Last edited by aprice67; 09-07-2017 at 12:44 PM. Reason: spelling
aprice67 is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 05:24 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2017, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO