SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Does a reliable consensus mean more reliable SNPs? lg36 Bioinformatics 1 06-04-2012 12:36 AM
HELP, primer design problem in gap closure f0415007 General 1 09-28-2011 02:44 AM
HELP, primer design problem in gap closure f0415007 Illumina/Solexa 0 09-20-2011 11:46 PM
Computational Gap Closure for 454 and Solid avtsanger Bioinformatics 1 08-19-2010 05:02 AM
PCR Primer Design Software for Gap-closure bulletin2007 454 Pyrosequencing 5 05-19-2010 11:58 AM

Reply
 
Thread Tools
Old 04-11-2014, 06:07 AM   #41
RhiP
Junior Member
 
Location: Urbana, IL

Join Date: Oct 2012
Posts: 1
Default error - invalid fastq

I am receiving an error when running SSPACE to get a scaffold for GAPfiller.
"ERROR: Invalid file in library Lib1: ~/scratch/bob/lotus/Illumina_3kb_1_R1.fastq -- fatal"

Below is what the head of my fastq file looks like and I don't see where there may be a formatting error. Has anyone else seen and fixed this error?

@DBRHHJN1:175:C011MACXX:3:1101:1149:1049 1:N:0:ATCACG
TCAGGGCATTTTTTGATGCTTCACATTCCTTATGG
+
;@@DDDDBHF?HAHCAFEEFF<<9CDDGEGHCFGF
@DBRHHJN1:175:C011MACXX:3:1101:1087:1093 1:N:0:ATCACG
TCACGAGTCAAGCTAACATAGCTTGTGAAAAGCCT
+
@@@FFDDD>DFHFFEEEGHIIEHHIIH@GGGGGEH

Thanks!

Last edited by RhiP; 04-15-2014 at 09:19 AM.
RhiP is offline   Reply With Quote
Old 06-26-2014, 01:28 AM   #42
DAPOR
Junior Member
 
Location: Norway

Join Date: Feb 2014
Posts: 3
Default

Hi,

I am am trying to use GapFiller. I succeed to run the test and everything works fine. The problems start when I try to use my data (of course). I have a 250 bp paired-end data in fastq file and the scaffold (in fasta) from SSPACE. When I run the command for GapFiller it seems that it does not load the fastq reads and I get this output.

""
Your inserted inputs on [GapFiller_v1-10] at Thu Jun 26 10:17:35 2014:
-s En.hirae_INFE1.fa
-l libraries.txt
-b test
-o 2
-m 30
-r 0.7
-n 10
-T 1
-g 1
-d 50
-t 10
-i 3


=>Thu Jun 26 10:17:35 2014: Reading and processing paired-read files

ITERATION 1:

=>Thu Jun 26 10:17:47 2014: Mapping reads to scaffolds, reading bowtie output and storing unmapped reads

=>Thu Jun 26 10:17:47 2014: Building BWA index for library lib1

=>Thu Jun 26 10:17:47 2014: Filling gaps

Closed 0 out of 0 gaps
Closed 0 out of 0 nucleotides

All gaps are closed. Exiting...

Process run successfully on Thu Jun 26 10:17:52 2014 in 0 minutes and 17 seconds
""

The fastq files are in the folder together with the library.txt file and the name is correct in the library.txt file.
This happen when I use bwa. If I use bowtie I get this error (like others):

Bowtie-build error; 256 at /Users/davipo/Desktop/fastq-tools/GapFiller_v1-10_/GapFiller.pl line 242.


If I run the test it works with both bowtie and bwa.

Someone knows what I do wrong?

Thanks

Davide
DAPOR is offline   Reply With Quote
Old 06-26-2014, 01:35 AM   #43
stepa_t
Junior Member
 
Location: Kaliningrad

Join Date: Jan 2013
Posts: 7
Default

Hi Davide,

I had the same issue when started to use GF. As I recall I've downloaded bowtie folder just from bowtie site ( bowtie-bio.sourceforge.ne ) and replaced "bowtie" folder in SSPACE folder.

Hope that helps.
Cheers,
Stepan
stepa_t is offline   Reply With Quote
Old 06-26-2014, 02:31 AM   #44
DAPOR
Junior Member
 
Location: Norway

Join Date: Feb 2014
Posts: 3
Default

Quote:
Originally Posted by stepa_t View Post
Hi Davide,

I had the same issue when started to use GF. As I recall I've downloaded bowtie folder just from bowtie site ( bowtie-bio.sourceforge.ne ) and replaced "bowtie" folder in SSPACE folder.

Hope that helps.
Cheers,
Stepan
Hi Stepan

Thanks. I tried again to download bowtie from the website and it works with another genome. I think I have some problem with the genome I was working before. I will try to fix it.

Davide
DAPOR is offline   Reply With Quote
Old 09-02-2014, 06:28 AM   #45
Tom_C
Member
 
Location: New Brunswick

Join Date: Aug 2012
Posts: 16
Default

Hello all,

I would like to use GapFiller, however am receiving the following error when running the command for Gapfiller:

-bash: ./GapFiller.pl: /usr/bin/perl^M: bad interpreter: No such file or directory

I am not quite computer savvy enough to figure this one out, anyone else getting this message?
Tom_C is offline   Reply With Quote
Old 09-02-2014, 06:56 AM   #46
usad
Member
 
Location: aachen

Join Date: Sep 2009
Posts: 53
Default

The ^M would indicate you have a windows file on a linux system.
Try dos2unix on the script and try again.
usad is offline   Reply With Quote
Old 10-31-2014, 07:32 PM   #47
a_crisp
Junior Member
 
Location: Cambridge

Join Date: May 2012
Posts: 3
Default Using single-end reads

Hi,
Is it possible to use the program with single-end reads? Specifically Pacbio reads.
Thanks,
Alastair
a_crisp is offline   Reply With Quote
Old 03-26-2015, 07:59 PM   #48
mht
Member
 
Location: California

Join Date: May 2012
Posts: 23
Default

Hi boetsie,

I notice that GapFiller is introducing N's into my contigs where it previously has nucleotides. I've tried -t 0 but it still does not work. Any idea why this is and how this can be solved?

Thanks.
mh


Correction: my bad, it's an actual gap. sorry about this.

Last edited by mht; 03-26-2015 at 08:02 PM.
mht is offline   Reply With Quote
Old 06-18-2015, 03:20 PM   #49
yifangt
Member
 
Location: Canada

Join Date: Feb 2011
Posts: 61
Default IMAGE manual

Hello,
Can anyone share your experience using IMAGE for gap closing. I could not get it run after a couple of hours try. I need you explain the options for IMAGE command line for me,
Code:
/absolute_path_of_image/image.pl -scaffolds scaffolds.fa -prefix 76bp -iteration 1 -all_iteration 10 -dir_prefix iter
Particularly the -prefix option. From my understanding, it is the prefix of the paired end fastq file.
1) Should the fastq file be in the current directory? which did not work in my case.
2) What if the reads are fasta files which are used for my assembly?
Try to find the manual by writing to the author/group, no response. Googled a while, no luck. Tried PAGIT which is now the bundle including IMAGE, no instruction either.

Thanks a lot!

YT
yifangt is offline   Reply With Quote
Old 04-21-2016, 09:15 AM   #50
toddknutson
Junior Member
 
Location: Minneapolis, MN

Join Date: Nov 2014
Posts: 2
Default

Quote:
Originally Posted by shuixia100 View Post
I am having same problem. did you figure out how to fix it?
You need to supply Gap Filler with a single FASTA (not multi-fasta) file. Thus, you need to submit a file like this:


>all_contigs_linked_with_N's
ACGTACGT
ACGTACGT
ACNNNNN
NNNNNNN
NNNNN
AC
GTACGTA


and NOT:
>contig1
ACTGT
>contig2
ACGTGACT
toddknutson is offline   Reply With Quote
Old 04-21-2016, 10:20 AM   #51
toddknutson
Junior Member
 
Location: Minneapolis, MN

Join Date: Nov 2014
Posts: 2
Default

You need to supply Gap Filler with a single FASTA (not multi-fasta) file. Thus, you need to submit a file like this:


>all_contigs_linked_with_N's
ACGTACGT
ACGTACGT
ACNNNNN
NNNNNNN
NNNNN
AC
GTACGTA


and NOT:
>contig1
ACTGT
>contig2
ACGTGACT
toddknutson is offline   Reply With Quote
Old 04-27-2016, 02:32 AM   #52
Markiyan
Senior Member
 
Location: Cambridge

Join Date: Sep 2010
Posts: 115
Question Can GapFiller accept known repeats sequences?

Can GapFiller accept know repeats sequences in multifasta format, and use those to improve repeats resolution?:

1. First map the known repeats to the assembly.
2. Avoid using reads anchored only in the repetitive region, and first rely only onto reads anchoring onto unique sequence flanking the repetitive regions.
3. Do a mini assembly of the gap caused by the repeat, if unable to close the gap de novo - use the repeat sequence as a base for consensus and map the mates/de novo miniassembly contigs to it. Correct the consensus, where contigs are of a sufficient quality (>Q35?) and have no high quality unaligned portions to the repeat consensus.

PS: While the pilon is quite a good tool, it has problems when used in the iterative mode (like IMAGE), that areas extending into the repeats attract all reads from the other repeat copies during the next mapping step, stalling the repeat extension/gap closures for the robed repeat copies.

PPS: Getting a repeats library for PCR-free datasets: get the median coverage for the assembly, and do subsambling with low coverage assembly (2x-4x) in order to get the repetitive sequences (check contig coverage for that).
Markiyan is offline   Reply With Quote
Old 03-27-2019, 10:41 PM   #53
jgroh
Junior Member
 
Location: Australia

Join Date: Jan 2019
Posts: 3
Default Does gapfiller create problems for downstream alignment

Hello,

I'm interested in using GapFiller, however I am wondering whether this might cause issues for downstream alignment. In particular, if the original assembly contigs comprise close to the entire genome, but they were not all able to be scaffolded, then will using GapFiller essentially cause these sequences to be duplicated in the final reference sequence? For instance if contig B was not able to be scaffolded between contig A and contig C, but paired reads can be used by GapFiller to fill in the sequence of contig B, this would mean that reads which originate from the sequence contained in contig B will map equivocally to both contig B and the scaffold in between contig A and contig C. Is this correct, and is not expected to create any problems such as genome inflation and equivocal mapping?

Jeff
jgroh is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 05:52 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2019, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO