SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Identifying contamination simonandrews Bioinformatics 11 09-30-2011 01:04 PM
SOAPsplice outputfiles ->type? brpet Bioinformatics 0 04-27-2011 05:51 AM
cufflinks library-type option damiankao Bioinformatics 0 11-26-2010 04:08 AM
Exon type problem asking... edge General 3 02-25-2010 07:40 AM
What file type is this? DrD2009 Bioinformatics 2 01-21-2010 05:57 PM

Reply
 
Thread Tools
Old 11-16-2009, 01:58 PM   #1
Bardj
UB Buffalo Bioinformatics
 
Location: Buffalo NY

Join Date: Nov 2009
Posts: 26
Default Need Help identifying file type

Hi, I recently started an internship in which I am working with Chip-seq analysis pipelines using the harvard developed spp packages. I was given a handful of test data to utilize in testing the pipeline. Unfortunately, I am very new to this whole project, and have struggled so far.

Here is a sample from the files I was given:


TGGCTATTTCTGTGTTTTTTTTGTATCGCGCTTAC 1 1 chr01 - 28673 28707
CACCAAGGCCATCTCTCACTCCATCGGTACTCGAT 1 2 chr01 - 229683 229717


This is two lines out of several thousands. All have the same format.

If anyone can help me identify this I would truly be grateful. Right now using the spp package It complains when I try and read in:
chip.data <- read.bin.maqmap.tags("chr01.fsa.hit");

The package complains saying it is an obsolete version of the file. When I try to use the read.mapmaq.tags(""); its just crashes R all together. I know its not eland, or bowtie.. so I am at a loss.

Thanks,
Jonathan

Bioinformatics
Canisius College 2010
bardj@canisius.edu
Bardj is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 05:05 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO