Need Help identifying file type

Bardj · 11-16-2009, 01:58 PM

Hi, I recently started an internship in which I am working with Chip-seq analysis pipelines using the harvard developed spp packages. I was given a handful of test data to utilize in testing the pipeline. Unfortunately, I am very new to this whole project, and have struggled so far.

Here is a sample from the files I was given:

TGGCTATTTCTGTGTTTTTTTTGTATCGCGCTTAC 1 1 chr01 - 28673 28707
CACCAAGGCCATCTCTCACTCCATCGGTACTCGAT 1 2 chr01 - 229683 229717

This is two lines out of several thousands. All have the same format.

If anyone can help me identify this I would truly be grateful. Right now using the spp package It complains when I try and read in:
chip.data <- read.bin.maqmap.tags("chr01.fsa.hit");

The package complains saying it is an obsolete version of the file. When I try to use the read.mapmaq.tags(""); its just crashes R all together. I know its not eland, or bowtie.. so I am at a loss.

Thanks,
Jonathan

Bioinformatics
Canisius College 2010
bardj@canisius.edu

Similar Threads
Thread	Thread Starter	Forum	Replies	Last Post
Identifying contamination	simonandrews	Bioinformatics	11	09-30-2011 01:04 PM
SOAPsplice outputfiles ->type?	brpet	Bioinformatics	0	04-27-2011 05:51 AM
cufflinks library-type option	damiankao	Bioinformatics	0	11-26-2010 04:08 AM
Exon type problem asking...	edge	General	3	02-25-2010 07:40 AM
What file type is this?	DrD2009	Bioinformatics	2	01-21-2010 05:57 PM

11-16-2009, 01:58 PM	#1
Bardj UB Buffalo Bioinformatics Location: Buffalo NY Join Date: Nov 2009 Posts: 26	Need Help identifying file type Hi, I recently started an internship in which I am working with Chip-seq analysis pipelines using the harvard developed spp packages. I was given a handful of test data to utilize in testing the pipeline. Unfortunately, I am very new to this whole project, and have struggled so far. Here is a sample from the files I was given: TGGCTATTTCTGTGTTTTTTTTGTATCGCGCTTAC 1 1 chr01 - 28673 28707 CACCAAGGCCATCTCTCACTCCATCGGTACTCGAT 1 2 chr01 - 229683 229717 This is two lines out of several thousands. All have the same format. If anyone can help me identify this I would truly be grateful. Right now using the spp package It complains when I try and read in: chip.data <- read.bin.maqmap.tags("chr01.fsa.hit"); The package complains saying it is an obsolete version of the file. When I try to use the read.mapmaq.tags(""); its just crashes R all together. I know its not eland, or bowtie.. so I am at a loss. Thanks, Jonathan Bioinformatics Canisius College 2010 bardj@canisius.edu