Distance between P5 and custom read 1 primer

[rgejman]

Dear all,

I have a minigene library which is amplified with P5/P7 sites that looks like this

[P7/barcode][constant region][ variable region ][18nt constant region][SP1][P5] (436nt total)

We sequenced this library using the standard Illumina read 1 primers @ low cluster density (~600k) + 25% PhiX. Unfortunately, only a small fraction of clusters passed filter because of the low sequence diversity. Before we redesign the library, we are considering using a custom primer to sequence over the constant region:

5' ACGCTCTTCCGATCTTTGGCCTGTTTGGCCTTA 3'

This custom primer is 33nt, 52% GC, Tm ~ 66ºC. It binds to the complete constant region along with half of SP1 (bolded). The first nucleotide after the primer is the first base of the variable region. It will be tested by PCR to make sure it amplifies from the amplicon.

Before we use it for sequencing, I wanted to know if anyone had any experience sequencing with a custom primer that does not immediately abut the P5 hybridization site. I assume this should be OK, but wanted to get other people's opinion on this and any other issue I should consider first. For instance, are there any modifications that should be included when ordering this primer (other than HPLC purification).

Many thanks!

Ron

[DStephens@NuGEN]

Hi rgejman,
Our Ovation SoLo RNA-Seq System uses a custom primer to overcome low-diversity sequence at the 5’ end of the library. Like your custom primer, there is overlap with the SP1 sequence and it does not abut the P5 hybridization sequence. We do not have any issues with sequencing libraries from this kit when the entire flow cell contains libraries from the kit. One issue to consider is that, due to the overlap in primer sequence, the custom primer cannot be mixed with the standard Illumina read 1 primer. This means that the entire flow cell must use the custom primer, which can be expensive depending on your experiment. Alternatively, we have found that we can use the standard primer successfully as long as the flow cell does not contain more than 60% of libraries from the SoLo kit. You might want to consider re-sequencing your libraries using the Illumina standard read 1 primer with a higher % of multiplexing from other libraries.

Hope that helps!