Hi,
I am trying to align short reads from Illumina with different aligners.
I have used the same .fq files to align with BWA, Bowtie and Maq.
BWA and Maq align without errors and give me the expected output files in the right format.
But when I use the same fq and reference files to align with Bowtie, I get the following:
My Command:
bowtie --chunkmbs 100 -p 2 -X 500 prefixDB -1 /path/to/file/file_1.fq -2 /path/to/file/file_2.fq result.sam
Result:
# reads processed: xxx
# reads with at least one reported alignment: yyy (57.06%)
# reads that failed to align: zzz (42.94%)
Reported aaa paired-end alignments to 1 output stream(s)
So that looks alright, but when I tried converting the resultant sam file to bam:
samtools view -bS -o result.bam result.sam
I get:
[samopen] no @SQ lines in the header.
[sam_read1] missing header? Abort!
So I indexted the reference.fasta file and tried:
samtools view -bt ref.fasta.fai result.sam > result.bam
I get:
[sam_header_read2] 1 sequences loaded.
Parse error at line 1: invalid CIGAR character
Aborted
Now this is the first line of result.sam (the file I am trying to convert to bam)
SRR034509.174/1 + NC_000913.2 1272036 GCACCACAGGCGTCGCCTATCGACTGCCAGAAGAGACGCTGGAGCAGGAACTAACCCTGTTGTGGAAGCGAGAGATGATTAATGGCTGTGTTTGTTTATCA IIII;III>-8II*II.IIIIII@II@:I.IIIIII567II?EI);>>DI,I?H0&7F8AB=*&.;F5';E.(0)2,?,44%$)%!&%#$&"$#$##%!#" 0 81:C>A,82:C>T,89:T>G,90:A>T,92:C>T,93:T>G,94:G>T,95:C>T,96:C>T,98:A>T,100:C>A
All lines follow the same format, which I realize doesn't look the a typical .sam file format (it has missing fields) and I am wondering where I have gone wrong, and how I can correct this.
Things to note:
- I am running the latest bowtie and samtools version
- My bowtie-build command on the reference.fasta has given me the right files as I have used them to align other .fq reads.
- As mentioned previously, BWA and Maq worked fine with the same data so its very likely nothing is wrong with that.
Thanks
I am trying to align short reads from Illumina with different aligners.
I have used the same .fq files to align with BWA, Bowtie and Maq.
BWA and Maq align without errors and give me the expected output files in the right format.
But when I use the same fq and reference files to align with Bowtie, I get the following:
My Command:
bowtie --chunkmbs 100 -p 2 -X 500 prefixDB -1 /path/to/file/file_1.fq -2 /path/to/file/file_2.fq result.sam
Result:
# reads processed: xxx
# reads with at least one reported alignment: yyy (57.06%)
# reads that failed to align: zzz (42.94%)
Reported aaa paired-end alignments to 1 output stream(s)
So that looks alright, but when I tried converting the resultant sam file to bam:
samtools view -bS -o result.bam result.sam
I get:
[samopen] no @SQ lines in the header.
[sam_read1] missing header? Abort!
So I indexted the reference.fasta file and tried:
samtools view -bt ref.fasta.fai result.sam > result.bam
I get:
[sam_header_read2] 1 sequences loaded.
Parse error at line 1: invalid CIGAR character
Aborted
Now this is the first line of result.sam (the file I am trying to convert to bam)
SRR034509.174/1 + NC_000913.2 1272036 GCACCACAGGCGTCGCCTATCGACTGCCAGAAGAGACGCTGGAGCAGGAACTAACCCTGTTGTGGAAGCGAGAGATGATTAATGGCTGTGTTTGTTTATCA IIII;III>-8II*II.IIIIII@II@:I.IIIIII567II?EI);>>DI,I?H0&7F8AB=*&.;F5';E.(0)2,?,44%$)%!&%#$&"$#$##%!#" 0 81:C>A,82:C>T,89:T>G,90:A>T,92:C>T,93:T>G,94:G>T,95:C>T,96:C>T,98:A>T,100:C>A
All lines follow the same format, which I realize doesn't look the a typical .sam file format (it has missing fields) and I am wondering where I have gone wrong, and how I can correct this.
Things to note:
- I am running the latest bowtie and samtools version
- My bowtie-build command on the reference.fasta has given me the right files as I have used them to align other .fq reads.
- As mentioned previously, BWA and Maq worked fine with the same data so its very likely nothing is wrong with that.
Thanks
Comment