SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > Illumina/Solexa



Similar Threads
Thread Thread Starter Forum Replies Last Post
A first look at Illumina’s new NextSeq 500 AllSeq Vendor Forum 105 03-13-2017 01:39 PM
Failed NextSeq 500 v2 runs w/ custom sequencing primer kakseq Illumina/Solexa 4 10-05-2016 05:25 PM
low clustering for Sureselect exome v6 on NextSeq bsvega Sample Prep / Library Generation 3 06-10-2016 06:57 AM
Questions about whole-exome sequencing on NextSeq 500 newtoseq Illumina/Solexa 3 11-02-2014 07:26 PM
100 Gb Data/Day – Nextseq 500 Sequencing Services Now Available on Genohub Genohub Vendor Forum 3 04-24-2014 08:28 AM

Reply
 
Thread Tools
Old 09-02-2016, 06:40 AM   #1
Johnwang
Member
 
Location: NE, USA

Join Date: Jun 2016
Posts: 14
Default low clustering and bad sequencing primer efficiency on NextSeq 500

I got low clustering and very bad sequencing primer efficiency on NextSeq 500 run in my MIP project. The sequencing primers (read1, read2 and two index primers) are customized. We have tried either to spike our primer into illumina sequencing primer wells or add them into optional wells which are designed specifically for costumer specific primers. Both didn't give use any sequencing results. Do anyone have any suggestions ? thanks.

Does any know what is typical Tm for sequencing primers from illumina ? Looks like our customer specific primers don't anneal to reads very well. Is there anything that I can do to improve it in our Nextseq 500 run ? Thank you in advance.

Last edited by Johnwang; 09-02-2016 at 06:45 AM.
Johnwang is offline   Reply With Quote
Old 09-02-2016, 01:50 PM   #2
luc
Senior Member
 
Location: US

Join Date: Dec 2010
Posts: 300
Default

Attached are the recommendations from Illumina, I believe people often use 5 degree higher Tms (using the default IDT oligoanalyzer calculations).
Attached Images
File Type: png annealing temperatures Illumina.png (34.8 KB, 48 views)
luc is offline   Reply With Quote
Old 09-22-2016, 06:12 PM   #3
Yepler
Member
 
Location: Tucson, AZ, USA

Join Date: Oct 2010
Posts: 22
Default

If you're still having the issue, send me a message; I had to do some dancing to get custom primers to work on the NextSeq and might be able to help out.
Yepler is offline   Reply With Quote
Old 09-23-2016, 06:11 AM   #4
Johnwang
Member
 
Location: NE, USA

Join Date: Jun 2016
Posts: 14
Default

Thank you. Here are primers used for MIP amplification and NextSeq.

Example of amplicon amplified with P7 and P5 in primers respectively:

REV_index6 CAAGCAGAAGACGGCATACGAGATCATGCCTAACACGCACGATCCGACGGTAGTGT
Index 6
FOR_index5 AATGATACGGCGACCACCGAGATCTACACACTGCATACATACGAGATCCGTAATCGGGAAGCTGAAG
Index 5
Custom primers used:
MIP_SEQ_FOR CATACGAGATCCGTAATCGGGAAGCTGAAG
MIP_SEQ_REV ACACTACCGTCGGATCGTGCGTGT
SEQ_index7 ACACTACCGTCGGATCGTGCGTGT
SEQ_index5 TTCAGCTTCCCGATTACGGATCTCGTATG
Johnwang is offline   Reply With Quote
Old 09-27-2016, 11:44 AM   #5
Yepler
Member
 
Location: Tucson, AZ, USA

Join Date: Oct 2010
Posts: 22
Default

Sorry it took me a few days to check back. I might have identified your problem, although it might also be colored by my own experiences.

I have quite small-insert libraries, and while they are homemade, they come out looking like standard Illumina dual-sided barcoded libraries. The only real difference is that the main read is sequenced with the Small RNA Sequencing Primer (from Illumina), which has a Tm of about 69 C, while the other Read1 primers in Illumina's mix have Tms around 74 C. When I tried sequencing my libraries on the NextSeq, what I saw was two lanes of decent sequence and two lanes of all Gs. If you know the NextSeq, you know that all Gs means (basically) that the cluster didn't sequence. But the cluster itself DID demultiplex, so the two index reads were successful.

I should point out here before someone asks - yes, I'd sequenced these libraries extensively on MiSeq and HiSeq prior to my NextSeq Adventures. I do a lot of sequencing! Anyhow, after a lot of back and forth with Illumina, we finally hit on the Tm of the Small RNA Sequencing Primer.

I couldn't make the primer longer, because there wasn't any extra room, so instead, I added LNA bases to bring the Tm up to ~74 C. I added the LNA primer to the Read1 custom position, and out came some gorgeous sequencing.

So...I quickly put your primer sequences through IDT's Tm calculator, and the Tms are pretty low. Can you increase them, either via length, or via LNAs, to nearer to 74?

I may be off the mark here, so feel free to send more details back. But after my headache, I'd look at Tm first.

Oh, and the other thing that might be helpful is to make sure that a "standard" library (you could use PhiX, in a pinch) DOES sequence well. I was lucky enough to have a very similar library that used the standard Read 1 primer, and that helped narrow down the issue.
Yepler is offline   Reply With Quote
Old 01-06-2017, 06:27 AM   #6
Johnwang
Member
 
Location: NE, USA

Join Date: Jun 2016
Posts: 14
Default

Hi Yepler, thanks for your response with suggestions. As you mentioned, my Tm is pretty low when you checked it on IDT oligo analyzer. I looked it on exiqon, it is close to 70C. I can do LNA to increase Tm of my sequencing primer up to ~74C based on the exiqon calculation, but will still be 65C on IDT. So assume, I just do LNA and trust Tm with exiqon. Any other suggestions? such as length of oligo and position of LNA. Thank you again.

John
Johnwang is offline   Reply With Quote
Old 01-06-2017, 01:08 PM   #7
Yepler
Member
 
Location: Tucson, AZ, USA

Join Date: Oct 2010
Posts: 22
Default

I used the Read 1 Sequencing Primer from Illumina as a baseline for the Tm calculations ('cause yes, all calculators seem different!).

There are now three LNA bases in my primer, in the middle of the primer, (in a pattern like this: LNA-base-base-LNA-base-base...). Don't put an LNA base at the 3' end as a "clamp" - that sounded like a good idea but ended up giving some very strange results.

Hope that helps and good luck.
Yepler is offline   Reply With Quote
Old 01-09-2017, 07:23 AM   #8
Johnwang
Member
 
Location: NE, USA

Join Date: Jun 2016
Posts: 14
Default

Hi Yepler,
Many thanks for your inform and suggestions. By the way, quick question for LNA oligos, is Standard Desalting good enough ? or have go with HPLC purity.

Johnwang is offline   Reply With Quote
Old 01-09-2017, 08:03 AM   #9
Johnwang
Member
 
Location: NE, USA

Join Date: Jun 2016
Posts: 14
Default my sequencing primer

Hi Yepler,
Here are my sequencing primers, would you please take a look and tell me if you have any suggestion. Thank you.

CTACCGTCGGAT+CGTG+CGTGT
ACGAGATCCGTAATC+GGGAA+GC+TGAAG
Johnwang is offline   Reply With Quote
Old 01-11-2017, 07:39 AM   #10
Yepler
Member
 
Location: Tucson, AZ, USA

Join Date: Oct 2010
Posts: 22
Default

To the best of my ability to tell, I think those should work out for you. Good luck, and please do let me know how it turns out.
Yepler is offline   Reply With Quote
Old 02-16-2017, 11:09 AM   #11
Johnwang
Member
 
Location: NE, USA

Join Date: Jun 2016
Posts: 14
Default new sequencing primers

Hi Yepler, the run with new sequencing primers worked perfectly. Thanks.
Johnwang is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 02:02 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2017, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO