EDIT: After learning a bit more about the technology I think I have figured out the answers to most of my problems. In short, yes the linkers are compatible and they are modified versions of those from the Illumina RNA v1/v1.5 kit. The sequences do not match those on the wiki because they are designed for single-index, single-read sequencing which is slightly different from what is presented in the Wiki. I didn't know what any of those terms meant 2 hours ago so that's probably why I was confused when I first posted this.
Hey everyone, this is my first post to the forums! I am very new to this technology and I am trying to read up as much as I can but I am still a little confused by some parts of it. I thought it would be best to just ask my question straight up and see what you guys think.
I honestly don't know how well known CRAC is around here so here is a brief summary: CRAC is similar to CLIP in various ways. You harvest cells (yeast in my case), crosslink in vivo/in vitro, purify protein of interest crosslinked to RNA of interest via IgG+TEV cleavage, then attach to nickel beads for further purification in denaturing conditions. Linkers are then added to the RNA sequence on-bead, including the addition of 32P between the 5' linker and RNA of interest. Note that the linkers are 5' adenylated and 3' blocked (ddC) and 5' linkers have an inverted ddT. The RNA-protein complex is run on SDS-PAGE, transferred, and the RNA is identified through autoradiography. Band is then excised, RNA extracted, amplified by RT/PCR, then Illumina sequenced (single end 50-bp).
Paper:http://www.ncbi.nlm.nih.gov/pubmed/19482942
I am trying to figure out if the linkers/oligos included in the paper are going to be compatible with the Illumina machine (HiSeq 2000) my facility offers. Or if I will have to make new ones.
3' linker: 5-rAppTCGTATGCCGTCTTCTGCTTGT/ddC/-3
5' linker: 5-/InvddT/GTTCAGAGUUCUACAGUCCGACGAUC-3
PCR Forw: 5-AATGATACTGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA-3
PCR Rev: 5-CAAGCAGAAGACGGCATACGA-3
(5' linker is a DNA-RNA hybrid, RNA portion italicized)
1. Will these linkers be compatible with the Illumina machine based on the specifications for my university's web page?
2. Will I need single index or dual index and will either choice change the linkers I will need?
3. I am a bit confused about the RT/PCR primers. Parts of it match what is listed on the university web page but other parts do not. Are they using older linker sequences?
Sorry, I am having a lot of new things thrown at me at the same time to figure this out. If you guys could give me some direction I would really appreciate it! Thank you.
Hey everyone, this is my first post to the forums! I am very new to this technology and I am trying to read up as much as I can but I am still a little confused by some parts of it. I thought it would be best to just ask my question straight up and see what you guys think.
I honestly don't know how well known CRAC is around here so here is a brief summary: CRAC is similar to CLIP in various ways. You harvest cells (yeast in my case), crosslink in vivo/in vitro, purify protein of interest crosslinked to RNA of interest via IgG+TEV cleavage, then attach to nickel beads for further purification in denaturing conditions. Linkers are then added to the RNA sequence on-bead, including the addition of 32P between the 5' linker and RNA of interest. Note that the linkers are 5' adenylated and 3' blocked (ddC) and 5' linkers have an inverted ddT. The RNA-protein complex is run on SDS-PAGE, transferred, and the RNA is identified through autoradiography. Band is then excised, RNA extracted, amplified by RT/PCR, then Illumina sequenced (single end 50-bp).
Paper:http://www.ncbi.nlm.nih.gov/pubmed/19482942
I am trying to figure out if the linkers/oligos included in the paper are going to be compatible with the Illumina machine (HiSeq 2000) my facility offers. Or if I will have to make new ones.
3' linker: 5-rAppTCGTATGCCGTCTTCTGCTTGT/ddC/-3
5' linker: 5-/InvddT/GTTCAGAGUUCUACAGUCCGACGAUC-3
PCR Forw: 5-AATGATACTGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA-3
PCR Rev: 5-CAAGCAGAAGACGGCATACGA-3
(5' linker is a DNA-RNA hybrid, RNA portion italicized)
1. Will these linkers be compatible with the Illumina machine based on the specifications for my university's web page?
2. Will I need single index or dual index and will either choice change the linkers I will need?
3. I am a bit confused about the RT/PCR primers. Parts of it match what is listed on the university web page but other parts do not. Are they using older linker sequences?
Sorry, I am having a lot of new things thrown at me at the same time to figure this out. If you guys could give me some direction I would really appreciate it! Thank you.