SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
cufflinks: input alignment from hisat2 dovah RNA Sequencing 5 05-09-2018 02:09 AM
XS tags in hisat2 alignment dovah Bioinformatics 4 08-07-2016 03:00 AM
BOWTIE2: How to randomly map a read to single alignment when read is multimapping? cbaudo Bioinformatics 5 01-27-2016 10:33 AM
Tophat-accepted_hits.bam file shows more read with samtools flagstat mehtaaditya RNA Sequencing 15 09-22-2015 11:37 AM

Reply
 
Thread Tools
Old 07-18-2018, 02:02 PM   #1
yip
Junior Member
 
Location: CA, USA

Join Date: Oct 2011
Posts: 5
Default HISAT2: a surprising read shows up in alignment results

I was spot-checking the output of alignment results from HISAT2 and noticed one read (CATCTTGTTTCACACTAGTCACATTCTTGTTTTAAGTGCCTTTAGTTTTAACAGTTCACTTTTTACAGTACTATTT shown below) that does not exist in my input fastq files. Is this the result of a bug or am I missing anything?

$ hisat2 -p 40 -x hg19/genome -1 read1.fq.gz -2 read2.fq.gz 2>/dev/null | grep CATCTTGTTTCACACTAGTCACATTCTTGTTTTAAGTGCCTTTAGTTTTAACAGTTCACTTTTTACAGTACTATTT
HISEQ:287:CCK1AANXX:5:2307:14574:99798 409 chr19 14733987 0 76M = 14733987 0 CATCTTGTTTCACACTAGTCACATTCTTGTTTTAAGTGCCTTTAGTTTTAACAGTTCACTTTTTACAGTACTATTT GGGGGGGGCGGGEGG>[email protected] AS:i:-5 ZS:i:-5 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:69G6 YT:Z:UP NH:i:2
$ zcat read1.fq.gz read2.fq.gz|grep CATCTTGTTTCACACTAGTCACATTCTTGTTTTAAGTGCCTTTAGTTTTAACAGTTCACTTTTTACAGTACTATTT
$ hisat2 -p 40 -x hg19/genome -1 read1.fq.gz -2 read2.fq.gz 2>/dev/null | grep HISEQ:287:CCK1AANXX:5:2307:14574:99798
HISEQ:287:CCK1AANXX:5:2307:14574:99798 137 chr10 33189363 0 76M = 33189363 0 AAATAGTACTGTAAAAAGTGAACTGTTAAAACTAAAGGCACTTAAAACAAGAATGTGACTAGTGTGAAACAAGATG [email protected]>GGEGGGCGGGGGGGG AS:i:-5 ZS:i:-5 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:6C69 YT:Z:UP NH:i:2
HISEQ:287:CCK1AANXX:5:2307:14574:99798 409 chr19 14733987 0 76M = 14733987 0 CATCTTGTTTCACACTAGTCACATTCTTGTTTTAAGTGCCTTTAGTTTTAACAGTTCACTTTTTACAGTACTATTT GGGGGGGGCGGGEGG>[email protected] AS:i:-5 ZS:i:-5 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:69G6 YT:Z:UP NH:i:2
HISEQ:287:CCK1AANXX:5:2307:14574:99798 69 chr10 33189363 0 * = 33189363 0 ATAAACATACAGTGGTCTGTTATGGCACTAACTCCCCGTACTCTGCGTTGGTATCAACGCAGAGTACGGGGAGTTA 33<::[email protected]GGEGGGG YT:Z:UP

The other two entries in the sam output with read name of HISEQ:287:CCK1AANXX:5:2307:14574:99798 are from my input fastq files as expected (a read pair).

I appreciate any comments. Thanks!
yip is offline   Reply With Quote
Old 07-18-2018, 05:58 PM   #2
yip
Junior Member
 
Location: CA, USA

Join Date: Oct 2011
Posts: 5
Default

Here's the answer (thanks to Daehwan from the HISAT2 team):
CATCTTGTTTCACACTAGTCACATTCTTGTTTTAAGTGCCTTTAGTTTTAACAGTTCACTTTTTACAGTACTATTT is the reverse complement of AAATAGTACTGTAAAAAGTGAACTGTTAAAACTAAAGGCACTTAAAACAAGAATGTGACTAGTGTGAAACAAGATG, which is read 1 of HISEQ:287:CCK1AANXX:5:2307:14574:99798.
yip is offline   Reply With Quote
Reply

Tags
hisat2

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 04:24 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO