Tweet
I'm using BWA MEM to align paired-end fastq files to two reference sequences (50bp and 80bp):
>ref1
TCGTAACGCAAGTTGGATACTCTCGA******************************GGATGTTGCCGTCCTCCTTGAAGT
>ref2
TCGTAACGCAAGTTGGATACTCTCGATTGCAAGTAGTCGATTGCATTGTCAATCTAGGATGTTGCCGTCCTCCTTGAAGT
These two sequences are idential except the middle bit. I then used samtools to filter out properly paired reads from each sequence based on identifiers but surprisingly it showed overwhelming majority of reads have the number of matches that correspond to **ref2** and 0 properly paired reads for **ref1**
I verified this result by repeating the process for each sequence individually and got the same output:
```
$ samtools flagstat mysam.sam
1055596 + 0 in total (QC-passed reads + QC-failed reads)
0 + 0 secondary
0 + 0 supplementary
0 + 0 duplicates
20960 + 0 mapped (1.99% : N/A)
1055596 + 0 paired in sequencing
527798 + 0 read1
527798 + 0 read2
0 + 0 properly paired (0.00% : N/A)
20934 + 0 with itself and mate mapped
26 + 0 singletons (0.00% : N/A)
0 + 0 with mate mapped to a different chr
0 + 0 with mate mapped to a different chr (mapQ>=5)
```
I then tried setting high values for gap opens and extension penalties in order to limit the chance that hits from alignments of **ref1** reads result in origin of **ref2**. By doing this, I now can see some properly paired reads from **ref1**. However, one thing I don't understand is that the total number of reads goes up while this number should go down because of gap penalties.
Here are the result (I combined ref1 and ref2 in one file called refx.fasta):
```
bwa mem -O 20 -E 20 refx.fasta R1.fastq.gz R2.fastq.gz > mysam.sam
samtools flagstat mysam.sam
1117216 + 0 in total (QC-passed reads + QC-failed reads)
0 + 0 secondary
61620 + 0 supplementary
0 + 0 duplicates
1116527 + 0 mapped (99.94% : N/A)
1055596 + 0 paired in sequencing
527798 + 0 read1
527798 + 0 read2
1053928 + 0 properly paired (99.84% : N/A)
1054666 + 0 with itself and mate mapped
241 + 0 singletons (0.02% : N/A)
6 + 0 with mate mapped to a different chr
5 + 0 with mate mapped to a different chr (mapQ>=5)```
```
bwa mem -O 30 -E 30 refx.fasta R1.fastq.gz R2.fastq.gz > mysam.sam
samtools flagstat mysam.sam
1121698 + 0 in total (QC-passed reads + QC-failed reads)
0 + 0 secondary
66102 + 0 supplementary
0 + 0 duplicates
1121007 + 0 mapped (99.94% : N/A)
1055596 + 0 paired in sequencing
527798 + 0 read1
527798 + 0 read2
1053912 + 0 properly paired (99.84% : N/A)
1054662 + 0 with itself and mate mapped
243 + 0 singletons (0.02% : N/A)
6 + 0 with mate mapped to a different chr
5 + 0 with mate mapped to a different chr (mapQ>=5)
```
Can someone explain to me:
1. Is it normal to see 0 properly paired reads in this case?
2. Why does disallowing reads with open and extension gaps increase the total of reads?
Many thanks
>ref1
TCGTAACGCAAGTTGGATACTCTCGA******************************GGATGTTGCCGTCCTCCTTGAAGT
>ref2
TCGTAACGCAAGTTGGATACTCTCGATTGCAAGTAGTCGATTGCATTGTCAATCTAGGATGTTGCCGTCCTCCTTGAAGT
These two sequences are idential except the middle bit. I then used samtools to filter out properly paired reads from each sequence based on identifiers but surprisingly it showed overwhelming majority of reads have the number of matches that correspond to **ref2** and 0 properly paired reads for **ref1**
I verified this result by repeating the process for each sequence individually and got the same output:
```
$ samtools flagstat mysam.sam
1055596 + 0 in total (QC-passed reads + QC-failed reads)
0 + 0 secondary
0 + 0 supplementary
0 + 0 duplicates
20960 + 0 mapped (1.99% : N/A)
1055596 + 0 paired in sequencing
527798 + 0 read1
527798 + 0 read2
0 + 0 properly paired (0.00% : N/A)
20934 + 0 with itself and mate mapped
26 + 0 singletons (0.00% : N/A)
0 + 0 with mate mapped to a different chr
0 + 0 with mate mapped to a different chr (mapQ>=5)
```
I then tried setting high values for gap opens and extension penalties in order to limit the chance that hits from alignments of **ref1** reads result in origin of **ref2**. By doing this, I now can see some properly paired reads from **ref1**. However, one thing I don't understand is that the total number of reads goes up while this number should go down because of gap penalties.
Here are the result (I combined ref1 and ref2 in one file called refx.fasta):
```
bwa mem -O 20 -E 20 refx.fasta R1.fastq.gz R2.fastq.gz > mysam.sam
samtools flagstat mysam.sam
1117216 + 0 in total (QC-passed reads + QC-failed reads)
0 + 0 secondary
61620 + 0 supplementary
0 + 0 duplicates
1116527 + 0 mapped (99.94% : N/A)
1055596 + 0 paired in sequencing
527798 + 0 read1
527798 + 0 read2
1053928 + 0 properly paired (99.84% : N/A)
1054666 + 0 with itself and mate mapped
241 + 0 singletons (0.02% : N/A)
6 + 0 with mate mapped to a different chr
5 + 0 with mate mapped to a different chr (mapQ>=5)```
```
bwa mem -O 30 -E 30 refx.fasta R1.fastq.gz R2.fastq.gz > mysam.sam
samtools flagstat mysam.sam
1121698 + 0 in total (QC-passed reads + QC-failed reads)
0 + 0 secondary
66102 + 0 supplementary
0 + 0 duplicates
1121007 + 0 mapped (99.94% : N/A)
1055596 + 0 paired in sequencing
527798 + 0 read1
527798 + 0 read2
1053912 + 0 properly paired (99.84% : N/A)
1054662 + 0 with itself and mate mapped
243 + 0 singletons (0.02% : N/A)
6 + 0 with mate mapped to a different chr
5 + 0 with mate mapped to a different chr (mapQ>=5)
```
Can someone explain to me:
1. Is it normal to see 0 properly paired reads in this case?
2. Why does disallowing reads with open and extension gaps increase the total of reads?
Many thanks