[Help!] How can I extract high quality reads from the output file of NovoAlign

qc.share · 09-27-2010, 09:41 AM

Hello Everyone,
Now, we are trying to extract uniquely aligned reads(or high quality reads) from the output file of Novoalign.
There are 5 different reads in this file(please see below), which kind of reads could be used to export the methylation signals(MeDIP-seq)?
In our Service Report, there are 2 kind of reads:
1) Aligned reads:The reads aligned to reference genome with no more than 2 mismatches.
2) Uniquely aligned reads: The reads aligned to the unique location in the genome.
I found that "Uniquely Aligned Reads" have more than 2 mismatches (for example:34G>C 35T>C 36G>T).

@HWUSI-EAS1522_100625:1:120:18868:18135#0/1 S AAGAGGTTTCCAACGAAGGCCTCAAACAGGTCAATG #################################### QC
@HWUSI-EAS1522_100625:1:2:3391:8944#0/1 S AAAGTAAAGTGTGATGAGGCATCGTGAACTGAAACC "0''')',((,33338AAAAAAAAAAAAAAAAAAAA8" U 37 54 >chr22 27508807 F . . . 1G>A 2C>A
@HWUSI-EAS1522_100625:1:120:18870:10840#0/1 S CCATTCCATTCCATTCCACTCCACACCACTCCACTG CCCAACBCCCCCCCCCCCC<CCCCACCCCCCCCCCA R 6
@HWUSI-EAS1522_100625:1:2:3509:1310#0/1 S AGTGAGGACCTGGATCGGCACAGCGCACTGCAGCGC )&)))00000AAAAAAAAAAAAAAAAAAAAAAAAAA U 6 96 >chr22 20772761 R . . .
@HWUSI-EAS1522_100625:1:2:3662:5720#0/1 S AGGACAAGCTGAGATGAATAGTGTTTTGCAAAGGAG "-'&'(3,,//AAAAAAAAAAAAAAAAAAAAAAAAAA" U 40 62 >chr22 33074711 R . . . 34G>C 35T>C 36G>T

So, If I want to choose high quality read to export methylation signal, which kind of read should I use?

Thanks very much, everyone!

qc.share

Similar Threads
Thread	Thread Starter	Forum	Replies	Last Post
How to extract mapped and unmapped raw reads from bwa's sam file ?	vaibhavvsk	Bioinformatics	11	02-07-2013 09:01 AM
Extract paired end reads from sff file.	ojy	Bioinformatics	4	12-13-2012 04:07 AM
Extract perfectly mapped reads from SAM/BAM file	Graham Etherington	Bioinformatics	2	07-21-2011 07:27 AM
Help:how to extrcate information from the output file of Novoalign mapping tools	qc.share	Illumina/Solexa	2	09-20-2010 06:31 PM
filter high quality solexa reads	strob	Bioinformatics	1	12-08-2009 05:19 AM

09-27-2010, 09:41 AM	#1
qc.share Junior Member Location: kansas CIty Join Date: Sep 2010 Posts: 3	[Help!] How can I extract high quality reads from the output file of NovoAlign Hello Everyone, Now, we are trying to extract uniquely aligned reads(or high quality reads) from the output file of Novoalign. There are 5 different reads in this file(please see below), which kind of reads could be used to export the methylation signals(MeDIP-seq)? In our Service Report, there are 2 kind of reads: 1) Aligned reads:The reads aligned to reference genome with no more than 2 mismatches. 2) Uniquely aligned reads: The reads aligned to the unique location in the genome. I found that "Uniquely Aligned Reads" have more than 2 mismatches (for example:34G>C 35T>C 36G>T). @HWUSI-EAS1522_100625:1:120:18868:18135#0/1 S AAGAGGTTTCCAACGAAGGCCTCAAACAGGTCAATG #################################### QC @HWUSI-EAS1522_100625:1:2:3391:8944#0/1 S AAAGTAAAGTGTGATGAGGCATCGTGAACTGAAACC "0''')',((,33338AAAAAAAAAAAAAAAAAAAA8" U 37 54 >chr22 27508807 F . . . 1G>A 2C>A @HWUSI-EAS1522_100625:1:120:18870:10840#0/1 S CCATTCCATTCCATTCCACTCCACACCACTCCACTG CCCAACBCCCCCCCCCCCC<CCCCACCCCCCCCCCA R 6 @HWUSI-EAS1522_100625:1:2:3509:1310#0/1 S AGTGAGGACCTGGATCGGCACAGCGCACTGCAGCGC )&)))00000AAAAAAAAAAAAAAAAAAAAAAAAAA U 6 96 >chr22 20772761 R . . . @HWUSI-EAS1522_100625:1:2:3662:5720#0/1 S AGGACAAGCTGAGATGAATAGTGTTTTGCAAAGGAG "-'&'(3,,//AAAAAAAAAAAAAAAAAAAAAAAAAA" U 40 62 >chr22 33074711 R . . . 34G>C 35T>C 36G>T So, If I want to choose high quality read to export methylation signal, which kind of read should I use? Thanks very much, everyone! qc.share