SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
bwa sampe error Mali Salmon Bioinformatics 14 10-27-2014 11:25 AM
bwa sampe very slow natpokah Bioinformatics 25 08-13-2013 10:18 AM
bwa sampe hanging krobison Bioinformatics 6 02-13-2013 12:57 PM
bwa sampe problem sszelinger Bioinformatics 3 06-15-2011 05:34 AM
bwa sampe 0.5.7 error? rcorbett Bioinformatics 2 04-22-2010 07:13 AM

Reply
 
Thread Tools
Old 05-26-2011, 02:38 PM   #1
patel
Junior Member
 
Location: MI

Join Date: May 2011
Posts: 3
Default BWA sampe problem

Hi,

Having trouble figuring out what I have done wrong to make BWA sampe give me a mess instead of a functional SAM file. The raw data are from a paired end Illumina sequencing run. The .sai files were made by using BWA aln to allign reads for each end of the pairs against hg19.

I can generate SAM files for end1 and end2 seperately using samse. But when I uses sampe, it fails to write a complete file. Instead it gets to the first pair where both ends have mapped and spits up a mess. (see below)

Meanwhile, when I compared the SAM files generated for the ends seperately the results make sense. There are an equal number of reads in both SAM files, not all the pairs mapped on both ends, but the that do are seperated by a distance consistent with an insert size that matches the library sequenced.

Wondering if anyone has experienced this problem and can make suggestions regarding what to do next.

-Patel-

From SAM file generated by SAMPE:
Quote:
[lalitp@ccmb-comp2 FASTQ]$ head -n 125 PEaln_4.sam
@SQ SN:chr1 LN:249250621
@SQ SN:chr2 LN:243199373
@SQ SN:chr3 LN:198022430
@SQ SN:chr4 LN:191154276
@SQ SN:chr5 LN:180915260
@SQ SN:chr6 LN:171115067
@SQ SN:chr7 LN:159138663
@SQ SN:chrX LN:155270560
@SQ SN:chr8 LN:146364022
@SQ SN:chr9 LN:141213431
@SQ SN:chr10 LN:135534747
@SQ SN:chr11 LN:135006516
@SQ SN:chr12 LN:133851895
@SQ SN:chr13 LN:115169878
@SQ SN:chr14 LN:107349540
@SQ SN:chr15 LN:102531392
@SQ SN:chr16 LN:90354753
@SQ SN:chr17 LN:81195210
@SQ SN:chr18 LN:78077248
@SQ SN:chr20 LN:63025520
@SQ SN:chrY LN:59373566
@SQ SN:chr19 LN:59128983
@SQ SN:chr22 LN:51304566
@SQ SN:chr21 LN:48129895
@SQ SN:chr6_ssto_hap7 LN:4928567
@SQ SN:chr6_mcf_hap5 LN:4833398
@SQ SN:chr6_cox_hap2 LN:4795371
@SQ SN:chr6_mann_hap4 LN:4683263
@SQ SN:chr6_apd_hap1 LN:4622290
@SQ SN:chr6_qbl_hap6 LN:4611984
@SQ SN:chr6_dbb_hap3 LN:4610396
@SQ SN:chr17_ctg5_hap1 LN:1680828
@SQ SN:chr4_ctg9_hap1 LN:590426
@SQ SN:chr1_gl000192_random LN:547496
@SQ SN:chrUn_gl000225 LN:211173
@SQ SN:chr4_gl000194_random LN:191469
@SQ SN:chr4_gl000193_random LN:189789
@SQ SN:chr9_gl000200_random LN:187035
@SQ SN:chrUn_gl000222 LN:186861
@SQ SN:chrUn_gl000212 LN:186858
@SQ SN:chr7_gl000195_random LN:182896
@SQ SN:chrUn_gl000223 LN:180455
@SQ SN:chrUn_gl000224 LN:179693
@SQ SN:chrUn_gl000219 LN:179198
@SQ SN:chr17_gl000205_random LN:174588
@SQ SN:chrUn_gl000215 LN:172545
@SQ SN:chrUn_gl000216 LN:172294
@SQ SN:chrUn_gl000217 LN:172149
@SQ SN:chr9_gl000199_random LN:169874
@SQ SN:chrUn_gl000211 LN:166566
@SQ SN:chrUn_gl000213 LN:164239
@SQ SN:chrUn_gl000220 LN:161802
@SQ SN:chrUn_gl000218 LN:161147
@SQ SN:chr19_gl000209_random LN:159169
@SQ SN:chrUn_gl000221 LN:155397
@SQ SN:chrUn_gl000214 LN:137718
@SQ SN:chrUn_gl000228 LN:129120
@SQ SN:chrUn_gl000227 LN:128374
@SQ SN:chr1_gl000191_random LN:106433
@SQ SN:chr19_gl000208_random LN:92689
@SQ SN:chr9_gl000198_random LN:90085
@SQ SN:chr17_gl000204_random LN:81310
@SQ SN:chrUn_gl000233 LN:45941
@SQ SN:chrUn_gl000237 LN:45867
@SQ SN:chrUn_gl000230 LN:43691
@SQ SN:chrUn_gl000242 LN:43523
@SQ SN:chrUn_gl000243 LN:43341
@SQ SN:chrUn_gl000241 LN:42152
@SQ SN:chrUn_gl000236 LN:41934
@SQ SN:chrUn_gl000240 LN:41933
@SQ SN:chr17_gl000206_random LN:41001
@SQ SN:chrUn_gl000232 LN:40652
@SQ SN:chrUn_gl000234 LN:40531
@SQ SN:chr11_gl000202_random LN:40103
@SQ SN:chrUn_gl000238 LN:39939
@SQ SN:chrUn_gl000244 LN:39929
@SQ SN:chrUn_gl000248 LN:39786
@SQ SN:chr8_gl000196_random LN:38914
@SQ SN:chrUn_gl000249 LN:38502
@SQ SN:chrUn_gl000246 LN:38154
@SQ SN:chr17_gl000203_random LN:37498
@SQ SN:chr8_gl000197_random LN:37175
@SQ SN:chrUn_gl000245 LN:36651
@SQ SN:chrUn_gl000247 LN:36422
@SQ SN:chr9_gl000201_random LN:36148
@SQ SN:chrUn_gl000235 LN:34474
@SQ SN:chrUn_gl000239 LN:33824
@SQ SN:chr21_gl000210_random LN:27682
@SQ SN:chrUn_gl000231 LN:27386
@SQ SN:chrUn_gl000229 LN:19913
@SQ SN:chrM LN:16571
@SQ SN:chrUn_gl000226 LN:15008
@SQ SN:chr18_gl000207_random LN:4262
@PG ID:bwa PN:bwa VN:0.5.9-r16
D7DHSVN1_0087:4:1:1238:1975#0 77 * 0 0 * * 0 0 TATGCCTTTAAGTTAACTGACATTTTCTTCTGCAATGTCTTTCTCTTCTGTTAATGCCACTCAGTGACAATTTTATTTTATATTATGTTCC BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BC:Z:NGGTTTTGGTTGATTTTTTTTGTATT XC:i:91
D7DHSVN1_0087:4:1:1238:1975#0 141 * 0 0 * * 0 0 CTTTCTGATTTTCTGTATATGTGTAATCATATTCATTTGCAAATAAAGAGATATTTTATAATTAGTGGTGTTTGTTATACTAGCCATGAGT cbceSd\bbcc_Vaddd^c\WXc`c`cdd\cN^XbM]aaV_VY^_Y]d_adBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BC:Z:NGGTTTTGGTTGATTTTTTTTGTATT XC:i:91
D7DHSVN1_0087:4:1:1304:1903#0 77 * 0 0 * * 0 0 ATGTATGATGGAGCTTCTGCCAACCATGGTGGGAAGAACTGATGCACAACTCATTCGCACCAAGGTATACGACTGAGACACTAGAATGGAG [V^^U^^^V^\^BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BC:Z:NGGGTGGTGGGGATTTTGGTGGGCAG XC:i:91
D7DHSVN1_0087:4:1:1304:1903#0 141 * 0 0 * * 0 0 TAAAATTACTGTCTGATCCCTGTGGACTTATGTGGACTGGTGTATGTTTTATTACAAAGGATTAATGTAAAGACAAACACAATGCACAACA bdfaNddcN\c_[\aBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BC:Z:NGGGTGGTGGGGATTTTGGTGGGCAG XC:i:91
D7DHSVN1_0087:4:1:1492:1904#0 77 * 0 0 * * 0 0 GTTTACGACATAAGGGAAGAGCCTTATGCTCCTCTTGTGGACTCCTGCCATGCAAAGAGCCAGCGCTTCTATACTCTGGCAGCTTCAGCTG BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BC:Z:NGGGGTGGGTGGTGTGTTTGTGGGAA XC:i:91
D7DHSVN1_0087:4:1:1492:1904#0 141 * 0 0 * * 0 0 GGAAAGAGAAAATGGATTTAGACTTCTCCAGGATTTTCTGATTACAAAAAAAATTGAGCATGCTCTCACACAGGAGCACAGAGTGCACACA `cb`cZWcdb\aa^WZcacWbN^U_BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BC:Z:NGGGGTGGGTGGTGTGTTTGTGGGAA XC:i:91
D7DHSVN1_0087:4:1:1362:1923#0 77 * 0 0 * * 0 0 TTTTGGGGAGGACCGTCACTCTCCCTTGGGATACTGATATCCAAATTGTAACTTCTCAGTAGGGTTTGTATGAACTGTACTTCACACACAC BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BC:Z:NTGGGTGGTGTGGGGGTTGGGTGTTG XC:i:91
D7DHSVN1_0087:4:1:1362:1923#0 141 * 0 0 * * 0 0 ATTTATAAGAAAACTGTGCAAATTAAGGCAAGTGGATCACTGTTCTACGAATACCGGTGTATCAGACTGCGACAAATGTTGGACATATTAC `_c_cKaV[]PR_]U_^c\\cWbM__aUM^^]XU]UTbM_JZWOK^U_BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BC:Z:NTGGGTGGTGTGGGGGTTGGGTGTTG XC:i:91
D7DHSVN1_0087:4:1:1417:1933#0 77 * 0 0 * * 0 0 TGCAGACTTCGGTAAAATCACATGGGGTACAAGTAAACAGTGCCAGTACAAGGATAAGCTGACAAAACTCTATACCCTGGCTAACACTAGG _____V_BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BC:Z:NGGTTGGGTGTGTGTTTTTTGTGCGT XC:i:91
D7DHSVN1_0087:4:1:1417:1933#0 141 * 0 0 * * 0 0 AAAAGGTAGAAGGTGATGAGGGGGAACCATATGGCCCTGTGTCTGTCAACACAAATCCATAACGGCTGAAGTACTCCCGCCAATGTCGTGA aefccdNcccabcXcbcbccb`ec^d^^__\PY`]Kb^_\_Q^Q]PXZ]][[ODUFPUTXMSJSSLV^[_^BBBBBBBBBBBBBBBBBBBB BC:Z:NGGTTGGGTGTGTGTTTTTTGTGCGT XC:i:91
D7DHSVN1_0087:4:1:1472:1944#0 77 * 0 0 * * 0 0 GGAGAAGACAGGATGAGATCAGTTCAAAGCAGATGCCTGGACAGTGGCGGCAGTGTTGTACACGATCCACATATCGGCACAATGTATATGG ^UUY[ZYM[][V^^UX\Z^^X^BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BC:Z:NTTTGTGTGTCCAGTGGTGGGGGTAA XC:i:91
D7DHSVN1_0087:4:1:1472:1944#0 141 * 0 0 * * 0 0 TATTTGTGTGGTTAAAAATGAAAAATGAGCACTATTTGTACACCCAACATTCATACAGTGAACATGATATACAGCGCACAGCACACTCACA da_^N]\IJZZNMZ^TXf_d_d_a`KY`SL[_BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BC:Z:NTTTGTGTGTCCAGTGGTGGGGGTAA XC:i:91
D7DHSVN1_0087:4:1:1449:1965#0 77 * 0 0 * * 0 0 ACTTTACCAAAAGTCATTCATTTCAGAAAGTCACATAATAACATTACAACATATATCAGTCTGCAGTGTAACTGTCACCTGCATAATACAA __UX\]V^\^BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BC:Z:NGGGGTGGTGGGACATTTTGTGGCAC XC:i:91
D7DHSVN1_0087:4:1:1449:1965#0 141 * 0 0 * * 0 0 TTTTTTGGCTATCTTGAAGTGGCATTCATAGATAAGTTAAATGGCCTCACATGTAACTTTTAAAAAGTTGATATCATGCTCAAGCGCTATA ^^V__BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BC:Z:NGGGGTGGTGGGACATTTTGTGGCAC XC:i:91
D7DHSVN1_0087:4:1:1317:1991#0 77 * 0 0 * * 0 0 GGGATCTCGCCATGTTGCCCAGACTAGGTATTCTATTTTAGATCCATGTACTTCTTGACGCAATGCTGTGTGAGGAGCAGCTGGCACTGCA BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BC:Z:NGTTTTTTGGGATTGGGGGGGTTGCA XC:i:91
D7DHSVN1_0087:4:1:1317:1991#0 141 * 0 0 * * 0 0 TACCTGGGGTCCTAGCTATTTGAGAGGCTCAGATGCGCGGGTTAATTGAGGCGCGTGGGACAACGCGTGGACGTAGCAGAGTGTGTCGACA b][`_VM_L]Y]a\d\d`aN[bBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BC:Z:NGTTTTTTGGGATTGGGGGGGTTGCA XC:i:91
D7DHSVN1_0087:4:1:1637:1912#0 77 * 0 0 * * 0 0 ACGCGAGAAGAAAGTGAGGACACGGAGAGCGATGGAGATGATGACGATCTTGTTTGCAAAGGGTCAACAGGAGGACAGACGCGCAAGACAC BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BC:Z:NGGTGGTGGTGAAGGTTTTGGGACTT XC:i:91
D7DHSVN1_0087:4:1:1637:1912#0 141 * 0 0 * * 0 0 GCGCCGACCCGTGACTGGTAGGTGTCTAGTAGTTTTGGGGGGGCTCTCGTATTGAGTGTGAGACCGGCTGCGCGCGGCACACAGCACGACG \\cb`Na\VTOM_^^^BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BC:Z:NGGTGGTGGTGAAGGTTTTGGGACTT XC:i:91
D7DHSVN1_0087:4:1:1728:1914#0 99 chr2 140326609 29 1S73M17S = 140326814 296 ACAGGAGAAAAAAAAAAAGCATATAAAGTGCCTCAACCAACTAGACATTGCTATGAAAAAAAACAAACACACAATGACAATTATCACGACGAAAAAAAAAAAAAqAAAAAAAoe n oeAAAAAAAAAAAAAqAAAAAAACGTCGTGATAATTGTCATTGTGTGTTTGTTTTTTTTCATAGCAATGTCTAGTTGGTTGAGGCACTTTATATGCTTTTTTTTTTTCTCCTGTAAAAAAAAAAAAAiAAAAAAAndàbioll:n:
:i:inn::ifi
flAiAAAAAAAAAqAAAAAAATTTACTGAACTATGAAAACAGCAGTGCCAATGGGGAAAATGTGATTGCTGCATTAAGCAAAAATAAATAAATAAAAGACAGAAACCCCAACAAAAAAAAAAAAAqAAAAAAAb??bcAAAAAAAAAAAAAqAAAAAAAGTTGGGGTTTCTGTCTTTTATTTATTTATTTTTGCTTAATGCAGCAATCACATTTTCCCCATTGGCACTGCTGTTTTCATAGTTCAGTAAAAAAAAAAAAAAAAiAAAAAAAndàbioll:n:
:i:ih:
:ifehflAiAAAAAAAAAqAAAAAAAAAATGCCCTGAGGTAGTCTTATTTGTGTTAAATCTGCTTGGTGCTCTATCACATTCTTGTACTTCAATGTTTATCTTTCCTTATGTTTGGAAAAAAAAAAAAAAqAAAAAAAlonooonoaoooa__awbbbblààacAAAAAAAAAAAAAqAAAAAAATCCAAACATAAGGAAAGATAAACATTGAAGTACAAGAATGTGATAGAGCACCAAGCAGATTTAACACAAATAAGACTACCTCAGGGCATTTAAAAAAAAAAAAAiAAAAAAAndàbioll:n:
:i:ih
:if
fflAiAAAAAAAAAqAAAAAAAGTAGATTACCGTCTCTCATGGGGTTAGAAGTTGATCTACCCTAGGGTTTTCTATCCTTGCTTTCACTGATATATATTTCTCCTGGTAGTTTAAAAAAAAAAAAAqAAAAAAAaacclccaooooooo oe AAAAAAAAAAAAAqAAAAAAAAAACTACCAGGAGAAATATATATCAGTGAAAGCAAGGATAGAAAACCCTAGGGTAGATCAACTTCTAACCCCATGAGAGACGGTAATCTACAAAAAAAAAAAAAiAAAAAAAndàbioll:n:
:i:inen:if
fflAiAAAAAAAAAqAAAAAAATGACGGTAGAACAACTTCAAATGAGAAAGCATCTGTTGGGGTTTGCTTATTTTGCAATGTAGGAATAAACAGACTTCAAACCTGTGACACAAAAAAAAAAAAAAqAAAAAAAaaccnbaccaccAAAAAAAAAAAAAqAAAAAAATGTGTCACAGGTTTGAAGTCTGTTTATTCCTACATTGCAAAATAAGCAAACCCCAACAGATGCTTTCTCATTTGAAGTTGTTCTACCGTCAAAAAAAAAAAAAAiAAAAAAAndàbioll:n:
:i:ih:n:ifhnflAiAAAAAAAAAqAAAAAAAAGTAGTTAGTATTGGTAGCATAATGATGACCTGAATCCCGGCTCATTAATTCAGTGGTCTACTTCACCTTTTCAATGTCACTCACCAAATAAAAAAAAAAAAAAqAAAAAAAAAAAAAAAAAAAAqAAAAAAATATTTGGTGAGTGACATTGAAAAGGTGAAGTAGACCACTGAATTAATGAGCCGGGATTCAGGTCATCATTATGCTACCAATACTAACTACTAAAAAAAAAAAAAiAAAAAAAndàbioll:n:
:i:ihnl:iff
flAiAAAAAAAAAqAAAAAAAAGCGGTGTAGGAGTACAATAAGAAATAGATACTTGGGAAATAAAAAATTATATTCCATACACATGAATGACTTTCATTGTGCTGATACTCTAAAAAAAAAAAAAqAAAAAAAan__aZalllllalaao loaac??c n AAAAAAAAAAAAAqAAAAAAAAGAGTATCAGCACAATGAAAGTCATTCATGTGTATGGAATATAATTTTTTATTTCCCAAGTATCTATTTCTTATTGTACTCCTACACCGCTAAAAAAAAAAAAAiAAAAAAAndàbioll:n:
patel is offline   Reply With Quote
Old 05-26-2011, 02:48 PM   #2
Richard Finney
Senior Member
 
Location: bethesda

Join Date: Feb 2009
Posts: 700
Default

check to make sure you didn't accidentally send stderr to stdout in your previous steps.
this is a common problem and may be what's biting you.
Richard Finney is offline   Reply With Quote
Old 05-26-2011, 03:06 PM   #3
patel
Junior Member
 
Location: MI

Join Date: May 2011
Posts: 3
Default

Hi Richard,

Thank you for your reply. I'm a bit of a newbee at this and don't actually know what step(s) would allow me to direct stderr to stdout. The commands I've used are given below, though. Did I mess something up?
Quote:
$ bwa aln -B 13 -t 1 hg19.fa s_4_1_sequence.txt > BWA_4_1.sai
$ bwa aln -B 13 -t 1 hg19.fa s_4_2_sequence.txt > BWA_4_2.sai

$ bwa samse hg19.fa BWA_4_1.sai s_4_1_sequence.txt > SEaln_4_1.sam
$ bwa samse hg19.fa BWA_4_2.sai s_4_2_sequence.txt > SEaln_4_2.sam

$ bwa sampe hg19.fa BWA_4_1.sai BWA_4_2.sai s_4_1_sequence.txt s_4_2_sequence.txt > PEaln_4.sam
Also - the following output was generated by the sampe run. Any idea what "segmentation fault" is or what would have caused it to occur?:
Quote:
[bwa_sai2sam_pe_core] convert to sequence coordinate...
[infer_isize] (25, 50, 75) percentile: (236, 281, 305)
[infer_isize] low and high boundaries: 98 and 443 for estimating avg and std
[infer_isize] inferred external isize from 150034 pairs: 263.375 +/- 64.224
[infer_isize] skewness: -1.005; kurtosis: 0.302; ap_prior: 1.19e-05
[infer_isize] inferred maximum insert size: 708 (6.93 sigma)
[bwa_sai2sam_pe_core] time elapses: 27.33 sec
[bwa_sai2sam_pe_core] changing coordinates of 6985 alignments.
[bwa_sai2sam_pe_core] align unmapped mate...
[bwa_paired_sw] 41375 out of 44459 Q17 singletons are mated.
[bwa_paired_sw] 817 out of 4055 Q17 discordant pairs are fixed.
[bwa_sai2sam_pe_core] time elapses: 23.21 sec
[bwa_sai2sam_pe_core] refine gapped alignments... 2.38 sec
[bwa_sai2sam_pe_core] print alignments... Segmentation fault
patel is offline   Reply With Quote
Old 05-26-2011, 03:34 PM   #4
Richard Finney
Senior Member
 
Location: bethesda

Join Date: Feb 2009
Posts: 700
Default

It looks good, I had to check out the barcode parameter [-B] ; I've never used it.
If that's your script or what you typed it looks fine.

If samse worked but sampe failed ... hmmmm. I'd start looking at the executable. Segfault just means the program tried to access memory it shouldn't have. Somewhere the code tried to access using a bad address. This is common in many errant Unix programs. The segfault message and the abrupt end of your output are consistent.

Did you download source BWA and type "make" ... or did someone play with the makefile first and added "-O3" [ the super optimize parameter ]? Are you on Linux? Do you have 4+ GB memory? Not having enough memory is very bad. BWA source doesn't check return values [ not necessarly a bad thing, it runs faster but assumes there's no problem with input or memory].



I have two desperation suggestions: 1) run with default parameters [ I doubt this is the problem] and 2) run "strings " command on you sai input files "strings BWA_4_2.sai" for instance. See any inconsistent junk that snuck in there?
Richard Finney is offline   Reply With Quote
Old 05-26-2011, 07:09 PM   #5
dp05yk
Member
 
Location: Brock University

Join Date: Dec 2010
Posts: 66
Default

All I have to say is.... good job! In all my time developing my parallel version of BWA I never once encountered an error like this.

I doubt it's a lack of memory - lack of memory would cause a segfault during the "convert to sequence co-ordinate" or "align unmapped mate" stages... you wouldn't even get to the print stage.

Can you provide the first 50 or so lines of one of your successfully generated .sam files using samse? Just enough to get to the first 5 sequences or so.
dp05yk is offline   Reply With Quote
Old 05-27-2011, 06:56 AM   #6
patel
Junior Member
 
Location: MI

Join Date: May 2011
Posts: 3
Default

Thank you for the replies.

Richard - I use a server the university has a setup for bioinformatics work. It has 100gb of ram and runs unix. Installation of BWA was done by the server admin. I don't think he modified the make file but will check. Thanks! I also ran strings on the SAI file. This gave alot of output, but I don't know what inconsistancies to be looking for in the output. Can you advise?

dp05yk - Not quite the accomplishment I was going for... The first lines including the first ~dozen reads in the samse file are provided below. Sorry for length (long header) and thank you for your help.
Quote:
$ head -n 115 SEaln_4_1.sam
@SQ SN:chr1 LN:249250621
@SQ SN:chr2 LN:243199373
@SQ SN:chr3 LN:198022430
@SQ SN:chr4 LN:191154276
@SQ SN:chr5 LN:180915260
@SQ SN:chr6 LN:171115067
@SQ SN:chr7 LN:159138663
@SQ SN:chrX LN:155270560
@SQ SN:chr8 LN:146364022
@SQ SN:chr9 LN:141213431
@SQ SN:chr10 LN:135534747
@SQ SN:chr11 LN:135006516
@SQ SN:chr12 LN:133851895
@SQ SN:chr13 LN:115169878
@SQ SN:chr14 LN:107349540
@SQ SN:chr15 LN:102531392
@SQ SN:chr16 LN:90354753
@SQ SN:chr17 LN:81195210
@SQ SN:chr18 LN:78077248
@SQ SN:chr20 LN:63025520
@SQ SN:chrY LN:59373566
@SQ SN:chr19 LN:59128983
@SQ SN:chr22 LN:51304566
@SQ SN:chr21 LN:48129895
@SQ SN:chr6_ssto_hap7 LN:4928567
@SQ SN:chr6_mcf_hap5 LN:4833398
@SQ SN:chr6_cox_hap2 LN:4795371
@SQ SN:chr6_mann_hap4 LN:4683263
@SQ SN:chr6_apd_hap1 LN:4622290
@SQ SN:chr6_qbl_hap6 LN:4611984
@SQ SN:chr6_dbb_hap3 LN:4610396
@SQ SN:chr17_ctg5_hap1 LN:1680828
@SQ SN:chr4_ctg9_hap1 LN:590426
@SQ SN:chr1_gl000192_random LN:547496
@SQ SN:chrUn_gl000225 LN:211173
@SQ SN:chr4_gl000194_random LN:191469
@SQ SN:chr4_gl000193_random LN:189789
@SQ SN:chr9_gl000200_random LN:187035
@SQ SN:chrUn_gl000222 LN:186861
@SQ SN:chrUn_gl000212 LN:186858
@SQ SN:chr7_gl000195_random LN:182896
@SQ SN:chrUn_gl000223 LN:180455
@SQ SN:chrUn_gl000224 LN:179693
@SQ SN:chrUn_gl000219 LN:179198
@SQ SN:chr17_gl000205_random LN:174588
@SQ SN:chrUn_gl000215 LN:172545
@SQ SN:chrUn_gl000216 LN:172294
@SQ SN:chrUn_gl000217 LN:172149
@SQ SN:chr9_gl000199_random LN:169874
@SQ SN:chrUn_gl000211 LN:166566
@SQ SN:chrUn_gl000213 LN:164239
@SQ SN:chrUn_gl000220 LN:161802
@SQ SN:chrUn_gl000218 LN:161147
@SQ SN:chr19_gl000209_random LN:159169
@SQ SN:chrUn_gl000221 LN:155397
@SQ SN:chrUn_gl000214 LN:137718
@SQ SN:chrUn_gl000228 LN:129120
@SQ SN:chrUn_gl000227 LN:128374
@SQ SN:chr1_gl000191_random LN:106433
@SQ SN:chr19_gl000208_random LN:92689
@SQ SN:chr9_gl000198_random LN:90085
@SQ SN:chr17_gl000204_random LN:81310
@SQ SN:chrUn_gl000233 LN:45941
@SQ SN:chrUn_gl000237 LN:45867
@SQ SN:chrUn_gl000230 LN:43691
@SQ SN:chrUn_gl000242 LN:43523
@SQ SN:chrUn_gl000243 LN:43341
@SQ SN:chrUn_gl000241 LN:42152
@SQ SN:chrUn_gl000236 LN:41934
@SQ SN:chrUn_gl000240 LN:41933
@SQ SN:chr17_gl000206_random LN:41001
@SQ SN:chrUn_gl000232 LN:40652
@SQ SN:chrUn_gl000234 LN:40531
@SQ SN:chr11_gl000202_random LN:40103
@SQ SN:chrUn_gl000238 LN:39939
@SQ SN:chrUn_gl000244 LN:39929
@SQ SN:chrUn_gl000248 LN:39786
@SQ SN:chr8_gl000196_random LN:38914
@SQ SN:chrUn_gl000249 LN:38502
@SQ SN:chrUn_gl000246 LN:38154
@SQ SN:chr17_gl000203_random LN:37498
@SQ SN:chr8_gl000197_random LN:37175
@SQ SN:chrUn_gl000245 LN:36651
@SQ SN:chrUn_gl000247 LN:36422
@SQ SN:chr9_gl000201_random LN:36148
@SQ SN:chrUn_gl000235 LN:34474
@SQ SN:chrUn_gl000239 LN:33824
@SQ SN:chr21_gl000210_random LN:27682
@SQ SN:chrUn_gl000231 LN:27386
@SQ SN:chrUn_gl000229 LN:19913
@SQ SN:chrM LN:16571
@SQ SN:chrUn_gl000226 LN:15008
@SQ SN:chr18_gl000207_random LN:4262
@PG ID:bwa PN:bwa VN:0.5.9-r16
D7DHSVN1_0087:4:1:1238:1975#0 4 * 0 0 * * 0 0 TATGCCTTTAAGTTAACTGACATTTTCTTCTGCAATGTCTTTCTCTTCTGTTAATGCCACTCAGTGACAATTTTATTTTATATTATGTTCC BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BC:Z:NGGTTTTGGTTGA
D7DHSVN1_0087:4:1:1304:1903#0 4 * 0 0 * * 0 0 ATGTATGATGGAGCTTCTGCCAACCATGGTGGGAAGAACTGATGCACAACTCATTCGCACCAAGGTATACGACTGAGACACTAGAATGGAG [V^^U^^^V^\^BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BC:Z:NGGGTGGTGGGGA
D7DHSVN1_0087:4:1:1492:1904#0 4 * 0 0 * * 0 0 GTTTACGACATAAGGGAAGAGCCTTATGCTCCTCTTGTGGACTCCTGCCATGCAAAGAGCCAGCGCTTCTATACTCTGGCAGCTTCAGCTG BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BC:Z:NGGGGTGGGTGGT
D7DHSVN1_0087:4:1:1362:1923#0 4 * 0 0 * * 0 0 TTTTGGGGAGGACCGTCACTCTCCCTTGGGATACTGATATCCAAATTGTAACTTCTCAGTAGGGTTTGTATGAACTGTACTTCACACACAC BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BC:Z:NTGGGTGGTGTGG
D7DHSVN1_0087:4:1:1417:1933#0 4 * 0 0 * * 0 0 TGCAGACTTCGGTAAAATCACATGGGGTACAAGTAAACAGTGCCAGTACAAGGATAAGCTGACAAAACTCTATACCCTGGCTAACACTAGG _____V_BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BC:Z:NGGTTGGGTGTGT
D7DHSVN1_0087:4:1:1472:1944#0 4 * 0 0 * * 0 0 GGAGAAGACAGGATGAGATCAGTTCAAAGCAGATGCCTGGACAGTGGCGGCAGTGTTGTACACGATCCACATATCGGCACAATGTATATGG ^UUY[ZYM[][V^^UX\Z^^X^BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BC:Z:NTTTGTGTGTCCA
D7DHSVN1_0087:4:1:1449:1965#0 4 * 0 0 * * 0 0 ACTTTACCAAAAGTCATTCATTTCAGAAAGTCACATAATAACATTACAACATATATCAGTCTGCAGTGTAACTGTCACCTGCATAATACAA __UX\]V^\^BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BC:Z:NGGGGTGGTGGGA
D7DHSVN1_0087:4:1:1317:1991#0 4 * 0 0 * * 0 0 GGGATCTCGCCATGTTGCCCAGACTAGGTATTCTATTTTAGATCCATGTACTTCTTGACGCAATGCTGTGTGAGGAGCAGCTGGCACTGCA BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BC:Z:NGTTTTTTGGGAT
D7DHSVN1_0087:4:1:1637:1912#0 4 * 0 0 * * 0 0 ACGCGAGAAGAAAGTGAGGACACGGAGAGCGATGGAGATGATGACGATCTTGTTTGCAAAGGGTCAACAGGAGGACAGACGCGCAAGACAC BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BC:Z:NGGTGGTGGTGAA
D7DHSVN1_0087:4:1:1728:1914#0 4 * 0 0 * * 0 0 ACAGGAGAAAAAAAAAAAGCATATAAAGTGCCTCAACCAACTAGACATTGCTATGAAAAAAAACAAACACACAATGACAATTATCACGACG _ac\c_aBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BC:Z:NTGGTGTTGGCTT
D7DHSVN1_0087:4:1:1684:1936#0 16 chr15 76521931 37 91M * 0 0 GTTGGGGTTTCTGTCTTTTATTTATTTATTTTTGCTTAATGCAGCAATCACATTTTCCCCATTGGCACTGCTGTTTTCATAGTTCAGTAAA BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB^VTTV BC:Z:NGGGTTGGGTTTC XT:A:U NM:i:3 X0:i:1 X1:i:0 XM:i:3 XO:i:0 XG:i:0 MD:Z:5A6T20T57
D7DHSVN1_0087:4:1:1564:1949#0 4 * 0 0 * * 0 0 AAATGCCCTGAGGTAGTCTTATTTGTGTTAAATCTGCTTGGTGCTCTATCACATTCTTGTACTTCAATGTTTATCTTTCCTTATGTTTGGA [_\___\_X___ZMYYXWVVVV[SSZ^BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BC:Z:NGGTTGGGTTATT
D7DHSVN1_0087:4:1:1737:1949#0 16 chr1 57881606 37 91M * 0 0 AAACTACCAGGAGAAATATATATCAGTGAAAGCAAGGATAGAAAACCCTAGGGTAGATCAACTTCTAACCCCATGAGAGACGGTAATCTAC BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBcccca_c_______Z^^[^^ZZ BC:Z:NGGGTTTTGTACA XT:A:U NM:i:1 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:80A10
D7DHSVN1_0087:4:1:1682:1962#0 4 * 0 0 * * 0 0 TGACGGTAGAACAACTTCAAATGAGAAAGCATCTGTTGGGGTTTGCTTATTTTGCAATGTAGGAATAAACAGACTTCAAACCTGTGACACA ZX^^\VX^^Z^^BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BC:Z:NGTGTGGTGGAAT
D7DHSVN1_0087:4:1:1620:1994#0 4 * 0 0 * * 0 0 AGTAGTTAGTATTGGTAGCATAATGATGACCTGAATCCCGGCTCATTAATTCAGTGGTCTACTTCACCTTTTCAATGTCACTCACCAAATA BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BC:Z:NTGTTGGGGTCTC
D7DHSVN1_0087:4:1:1895:1905#0 16 chr2 193690823 37 91M * 0 0 AGAGTATCAGCACAATGAAAGTCATTCATGTGTATGGAATATAATTTTTTATTTCCCAAGTATCTATTTCTTATTGTACTCCTACACCGCT BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBc\cc^TT^ZX_[c_XZ[RX[[[[[ZGZYY\Z BC:Z:NGTGTGTGGTTCA XT:A:U NM:i:2 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:3T84A2
D7DHSVN1_0087:4:1:1820:1909#0 4 * 0 0 * * 0 0 ATATTCAACATTCTTAGACAAAAAATCGTCAACCAATAAATTCATATTCAGACAACATAAGCTTCCTAAGTGAACATGAAATAACTTTGTT BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BC:Z:NGGGTGGGGTCTT
D7DHSVN1_0087:4:1:1979:1915#0 0 chr8 129688366 25 91M * 0 0 TTCTGTTCTGTTGGTCTATGTGTCTGTTTTTGTGCCAGTACCATACTGTTTTGGTTAACGTACTCTTCTATTATAGTTTGAATTCAGGGAG BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BC:Z:NGTGTGTTGTCTA XT:A:U NM:i:4 X0:i:1 X1:i:0 XM:i:4 XO:i:0 XG:i:0 MD:Z:58T8A4C15T2
D7DHSVN1_0087:4:1:1786:1927#0 16 chr18 49501580 37 91M * 0 0 TGGCTTTATTTCTGGATTCTCTATTCTGTTCCATTGGTCTATGTGCCCATTTGTATACCAGTGCCATGCGAATAATCAGAGAGATGTAAAT BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB____Z______cMac_______cXc__ BC:Z:NGGTGTGGTTTTG XT:A:U NM:i:1 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0 MD:Z:62A28
D7DHSVN1_0087:4:1:1916:1924#0 16 chr2 158251005 25 91M * 0 0 TGAAAAACTTAGAGATGAAGAGAAGGGGATCTGTAGACTGATAGAACAGCATAAATAAAACCCTAATGCCAAGGAAGCTTGGGAGTGAGAT BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB_U_\_VVQOMFPERTGUQUU_\XacV\^^Vcc_______ZX\ZU\__ BC:Z:NTTTTGTGTTCTC XT:A:U NM:i:4 X0:i:1 X1:i:0 XM:i:4 XO:i:0 XG:i:0 MD:Z:1C5T5A74A2
D7DHSVN1_0087:4:1:1759:1968#0 4 * 0 0 * * 0 0 ATGAGATCTGCTGAGGAAAGAGGGCCACCCCATGAGAATCTCCAAAATGCGAGGCTACGCAGACACAGGGCAAAGCTGAAAAGGAGACATG _SYXYMY^\Z\XXPXZVZ^BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB BC:Z:NTGTTGGGTGTGG
patel is offline   Reply With Quote
Old 05-27-2011, 07:46 AM   #7
Richard Finney
Senior Member
 
Location: bethesda

Join Date: Feb 2009
Posts: 700
Default

You'd see text error message or some other nonsense. sai files are binary files and you should NOT see anything human readable.

Are other people using the 100GB? It's free memory that's important here.

I need me one of them 100GB machines. *sigh*

Other then that, I'm truly stumped.
Richard Finney is offline   Reply With Quote
Old 07-09-2011, 02:03 PM   #8
David Witherspoon
Junior Member
 
Location: United States

Join Date: Jun 2011
Posts: 1
Default

I've generated a similar error, if anyone is interested in debugging.

I used bwa aln to align read 1 and read 3 separately (read 2 is an unorthodox index read), then bwa sampe to try to do the paired-end mapping.

First time around, I got:
...
[bwa_sai2sam_pe_core] print alignments... 1289.32 sec
*** glibc detected *** bwa: double free or corruption (out): 0x0000000014075600 ***

...

so (just for fun) I tried
export MALLOC_CHECK_=0
before running bwa sampe.

That ended with
...
[bwa_sai2sam_pe_core] print alignments... 1816.72 sec
Segmentation fault


bwa sampe is writing .sam files of >70Gb, and the mapping info is not properly formed, e.g.:
...
@SQ SN:chrY LN:59373566
@PG ID:bwa PN:bwa VN:0.5.9-r16
HWUSI-EAS1795_0000:6:1:2046:1016#0 73 chr19 57111889 37 40M = 57111889 0 AGCCATCCCCACATTCCCCCCACCCTTCCACTACCCTTCC^@AAAAAAA^@
^@^@^@^@^@^@^@^@^@^@^@^@^@^@^@^@^@^@^@^@^@^@^@^@^@^@^@^@^@^@^@^@^@^@^@^@^@^@^@AAAAAAAAAAAAAAAAiAAAAAAAGGAAGGGTAGTGGAAGGGTGGGGGGAATGTGGGGATGGCTiAAAAAAAdw[<E0>;R<AC>^@<E0>inf^@ollll:h:i:nl

...

125 Gb RAM, ~80 Gb free at the moment, bwa doesn't seem to be using much memory, plenty of disk space available.

I'm also using the -B option on the first read ... I betcha ... yep.

So instead of using -B to trim the barcode off of the first read on the fly, I trimmed it with a perl script, re-ran bwa aln on the newly-trimmed read, then ran bwa sampe on the .sai files and the trimmed .fastq file instead of the original one. The output .sam file is now properly formed (which is not to say the data are any good, but that's a different question.)

HTH.

Last edited by David Witherspoon; 07-09-2011 at 02:38 PM.
David Witherspoon is offline   Reply With Quote
Old 10-24-2011, 04:38 AM   #9
wanguan2000
Member
 
Location: shanghai

Join Date: Nov 2010
Posts: 24
Default

Today, I have the same problem like U said.
I have alignment whole genome sequencing pair-end data.(r1.fastq 140G ,r2.fastq 130G)
and centos6 with memory 64G
But when I do BWA sampe, I got the incomplete sam file. the number of reads in sam file were small the reads in fastq file. Normally, the number of reads in sam file should be equal the reads in both fastq files(r1.fastq +r2.fastq).
but I get no Error in bwa sampe command.
I have run several times and got the same results.
what's the problem? not enough memory?
my sam file last line:
HWI-ST966:590B5UACXX:1:1302:17663:189522 163 chr1 179091721 60 100M= 179091948 327 AAATATATATATATTTTCAAATATATATATACTCAAATTATGTATTTTTTCAAATATATATTTCTTTTTCTTTTTTTCTTTTTTTTGAGACAGAGTCTCA <@@FFFDDBHFBHDHIIJJIGGCAIIIA<FEHGHHJII
incomplete!!!

Last edited by wanguan2000; 10-24-2011 at 04:44 AM.
wanguan2000 is offline   Reply With Quote
Old 10-24-2011, 05:11 AM   #10
Richard Finney
Senior Member
 
Location: bethesda

Join Date: Feb 2009
Posts: 700
Default

Please post the first few lines of both input fastq files.
This problem in this case is usually that the fastq is not pristine.
BWA doesn't do a great job for checking for good input, it just goes at it. Not checking input greatly increases the speed of BWA, though, which is a good thing.
Richard Finney is offline   Reply With Quote
Reply

Tags
alignment tool, bwa, paired end reads, sam, sampe

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 07:17 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO