SEQanswers

Go Back   SEQanswers > Bioinformatics > Bioinformatics



Similar Threads
Thread Thread Starter Forum Replies Last Post
Contig vs contig or map against contig lib? JackieBadger Bioinformatics 1 05-30-2016 05:34 AM
How To: Contig to Scaffold? fahmida Bioinformatics 3 08-22-2013 04:41 AM
scaffold and contig chengeng Bioinformatics 5 07-04-2013 06:15 AM
SRMA Problem SAMRecord contig does not match the current reference sequence contig gavin.oliver Bioinformatics 5 07-05-2011 05:28 AM
finding polymorphisms by large sequence alignments Alex Clop Bioinformatics 8 11-24-2008 06:52 PM

Reply
 
Thread Tools
Old 03-07-2013, 04:19 AM   #1
fahmida
Member
 
Location: Australia

Join Date: Aug 2010
Posts: 54
Default finding hangovers in contig/scaffold alignments

Hi,

We have a nearly completed eukaryotic genome assembled into several thousand scaffolds (total lenghth is~350MB). There are ~8000 gaps (NNNs) in those scaffolds. Recently we received de-novo assembled contigs from a different strain of the same species. When compared (blast/blat etc.), What program/script would be most suitable:
1) To find all the contigs overlapping with the gap region of the scaffolds i.e. the overhangs as shown below:

scaff1: ACGTACGTCCCGCCCGCGCNNNNNNNNNNNNNNN
contig: ACGTACGTCCCGCCCGCGCTACGCCGCGT

2) For a good quality overlap (e.g. 50bp overlap with 2 matches) extend the scaffold with the sequence from the matched contig.

Thanks.
fahmida is offline   Reply With Quote
Old 03-07-2013, 04:30 AM   #2
GenoMax
Senior Member
 
Location: East Coast USA

Join Date: Feb 2008
Posts: 7,049
Default

Give Mauve (http://gel.ahabs.wisc.edu/mauve/) a try.

CoGe (http://genomevolution.org/CoGe/) and GEvo (http://genomevolution.org/wiki/index.php/GEvo) may be other possibilities.

Last edited by GenoMax; 03-07-2013 at 04:33 AM.
GenoMax is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 09:58 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO