SEQanswers

Go Back   SEQanswers > Literature Watch



Similar Threads
Thread Thread Starter Forum Replies Last Post
ChIP-Seq: Integrative genomic analysis of human ribosomal DNA. Newsbot! Literature Watch 0 03-01-2011 02:30 AM
PubMed: Transcriptome sequencing and comparative analysis of cucumber flowers with di Newsbot! Literature Watch 0 06-23-2010 02:00 AM
PubMed: Characterization of the Melanoma miRNAome by Deep Sequencing. Newsbot! Literature Watch 0 03-20-2010 02:00 AM
PubMed: RNA-Seq: a method for comprehensive transcriptome analysis. Newsbot! Literature Watch 0 01-14-2010 02:10 AM
PubMed: High-resolution analysis of the 5'-end transcriptome using a next generation Newsbot! Literature Watch 0 01-03-2009 05:26 AM

Reply
 
Thread Tools
Old 02-25-2010, 02:00 AM   #1
Newsbot!
RSS Posting Maniac
 

Join Date: Feb 2008
Posts: 1,443
Default PubMed: Integrative analysis of the melanoma transcriptome.

Syndicated from PubMed RSS Feeds

Integrative analysis of the melanoma transcriptome.

Genome Res. 2010 Feb 23;

Authors: Berger MF, Levin JZ, Vijayendran K, Sivachenko A, Adiconis X, Maguire J, Johnson LA, Robinson J, Verhaak RG, Sougnez C, Onofrio RC, Ziaugra L, Cibulskis K, Laine E, Barretina J, Winckler W, Fisher DE, Getz G, Meyerson M, Jaffe DB, Gabriel SB, Lander ES, Dummer R, Gnirke A, Nusbaum C, Garraway LA

Global studies of transcript structure and abundance in cancer cells enable the systematic discovery of aberrations that contribute to carcinogenesis, including gene fusions, alternative splice isoforms, and somatic mutations. We developed a systematic approach to characterize the spectrum of cancer-associated mRNA alterations through integration of transcriptomic and structural genomic data, and we applied this approach to generate new insights into melanoma biology. Using paired-end massively parallel sequencing of cDNA (RNA-seq) together with analyses of high-resolution chromosomal copy number data, we identified 11 novel melanoma gene fusions produced by underlying genomic rearrangements, as well as 12 novel readthrough transcripts. We mapped these chimeric transcripts to base-pair resolution and traced them to their genomic origins using matched chromosomal copy number information. We also used these data to discover and validate base-pair mutations that accumulated in these melanomas, revealing a surprisingly high rate of somatic mutation and lending support to the notion that point mutations constitute the major driver of melanoma progression. Taken together, these results may indicate new avenues for target discovery in melanoma, while also providing a template for large-scale transcriptome studies across many tumor types.

PMID: 20179022 [PubMed - as supplied by publisher]



More...
Newsbot! is offline   Reply With Quote
Old 04-07-2010, 09:27 PM   #2
Jon_Keats
Senior Member
 
Location: Phoenix, AZ

Join Date: Mar 2010
Posts: 279
Default

Anyone know how (they/you can) mapped to the reference "transcriptome" and then cross-mapped those alignments to the genome to capture exon-exon junctions? I really like this analysis concept. Seems simple enough to align a dataset to a transcriptome reference but then how to you assign these alignments to genome coordinates?
Jon_Keats is offline   Reply With Quote
Old 04-20-2010, 02:55 PM   #3
newbee
Junior Member
 
Location: CA

Join Date: Apr 2010
Posts: 1
Default BAM file flagstats

I have never used RNA seq data -- so I decided to repeat some analysis from above paper:

I download supplemental data from

http://www.ncbi.nlm.nih.gov/sites/en...&term=GSE17593[Accession]&cmd=search

http://www.ncbi.nlm.nih.gov/geo/quer...i?acc=GSE17593

Run samtools flagstat on bam file :

I have hard time understanding the flagstats output

For e.g.
samtools flagstats GSM506401_MEWO.paired.bwa.remapped.bam > GSM506401_MEWO.paired.bwa.remapped.bam.flagstats

GSM506401_MEWO.paired.bwa.remapped.bam.flagstats
10361094 in total
0 QC failure
3784092 duplicates
10361094 mapped (100.00%)
10361094 paired in sequencing
5180547 read1
5180547 read2
0 properly paired (0.00%)
10361094 with itself and mate mapped
0 singletons (0.00%)
0 with mate mapped to a different chr
0 with mate mapped to a different chr (mapQ>=5)

Sample :
SL-XAN_2_FC30BV1AAXX:1:47:1108:971 161 chrM 2 37 51M = 416 0 ATCACAGGTCTATCACCCTATTAACCACTC
ACGGGAGCTCTCCATGCATTT 77777777777777777777777777777766644122122222222.222 XT:A:U NM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0
MD:Z:51
SL-XAN_2_FC30BV1AAXX:1:17:1367:1052 97 chrM 3 37 51M = 411 0 TCACAGGTCTATCACCCTATTAACCACTCA
CGGGAGCTCTCCATGCATTTT 77777777777777777777777777777774+44-222222/2222222" XT:A:U NM:i:1 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0
MD:Z:50G0
SL-XAN_2_FC30BV1AAXX:1:48:1493:1675 161 chrM 3 37 51M = 396 0 TCACAGGGCTATCACCCTATTAACCACTCA
CGGGAGCGCTCCATGCATTTG 66,66666666666666666(66666666$66'6+,2'22!)'2,22,222 XT:A:U NM:i:2 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0
MD:Z:7T29T13
SL-XAN_2_FC30BV1AAXX:1:2:1699:495 1121 chrM 3 37 51M = 411 0 TCACAGGTCTATCACCCTATTAACCACTCA
CGGGAGCTCTCCATGCATTTT 7753577770757777777777777-777-71+1'/22221/%2/2*222" XT:A:U NM:i:1 X0:i:1 X1:i:0 XM:i:1 XO:i:0 XG:i:0
MD:Z:50G0
SL-XAN_2_FC30BV1AAXX:1:94:521:1276 97 chrM 4 37 51M = 326 0 CACAGGTCTATCACCCTATTAACCACTCAC
GGGAGCTCTCCATGCATTTGG 77777777777777777777777777777707777222222/2/2*222/% XT:A:U NM:i:0 X0:i:1 X1:i:0 XM:i:0 XO:i:0 XG:i:0
MD:Z:51



a) I am assuming these are mapped bam files (From paper : "Alignments were performed using the Burrows-Wheeler Alignment Tool (BWA), allowing up to four mismatches with the reference")
b) Please can somebody help me understand flagstats -- it is 100% mapped but there are "0 properly paired" reads
c) Please also let me know if you have any suggestions for software package -- which can be used explore this data.

Thanks

Last edited by newbee; 04-20-2010 at 03:01 PM.
newbee is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 11:34 AM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO