Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • PCR after size selection of cDNA library

    Hi all,

    Recently I'm trying to make cDNA library using Tag-seq protocol.
    After amplifying my sample with illumina adapter, I select 300~500bp size (0.5x TAE, Zymo Gel DNA recovery kit)
    However, I found that sample concentration is too low, so I re-amplified them with illumina adapter but, concentration was lower than before (PCR doesn't work)

    -> Size select before adding adapter is impossible (too low concentration)
    -> Gel elution kit work well with other experiment (cloning, etc...)
    -> My PCR condition : (98C 30sec, [98C 10sec, 72C 30sec, 72C 60sec] , 72C 5min) This condition works well in first amplification.

    Any comments would be welcomed.

  • #2
    Could you point us to your complete protocol? There are multiple Tag-seq protocols out there.
    Likely your first amplification was already failing.
    Your PCR cycles shows two consecutive stages at 72C - this likely a typo?

    Comment


    • #3
      Thanks luc.
      I adopted protocol from here.


      However, it doesn't fit well with our lab's reagents so I changed some conditions.
      This protocol is for Truseq but I need iSeq library. Because of this reason, after reverse transcription, I designed primer which can attach both 3',5' region of cDNA and have a sequence for i7 and i5 adapter site.

      The reason why I set annealing temperature as 72C is dimer problem. Actually, I started PCR from 65C but lots of dimer found. Also, I found dimer melting temperature peak at 70C in qPCR output.
      When I changed melting temperature at 72C, total amount of sample was increased by 3~4 fold (7 cycle)

      You can check some images that I uploaded
      1. Gel pic before gel elution.
      2. qPCR after 72C results
      Attached Files

      Comment


      • #4
        Hi Kujin,

        to my knowledge the Lohman protocol should work, as is, on the iSeq - as any other Truseq library design. We do not have an iSeq however. Do you want to optimize it for paired-end sequencing or why would you want to modify it?

        We can only guess what is happening during your amplification since we do not have primer sequences etc. It does not sound like a good idea to put the same common sequences on to both 3'and 5' ends.

        For example the
        "5 Ill" CTACACGACGCTCTTCCGATCT primer of the Lohman protocol has a (IDT analyzer) Tm of only 58.3 ºC and might not work at all at 72ºC in your buffer.

        Comment

        Latest Articles

        Collapse

        • seqadmin
          Essential Discoveries and Tools in Epitranscriptomics
          by seqadmin




          The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
          04-22-2024, 07:01 AM
        • seqadmin
          Current Approaches to Protein Sequencing
          by seqadmin


          Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
          04-04-2024, 04:25 PM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by seqadmin, Today, 08:47 AM
        0 responses
        11 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 04-11-2024, 12:08 PM
        0 responses
        60 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 04-10-2024, 10:19 PM
        0 responses
        59 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 04-10-2024, 09:21 AM
        0 responses
        54 views
        0 likes
        Last Post seqadmin  
        Working...
        X