SEQanswers

Go Back   SEQanswers > Sequencing Technologies/Companies > SOLiD



Similar Threads
Thread Thread Starter Forum Replies Last Post
Doubts about GATK "raw data processing" step for SOliD exome data jorgebm Bioinformatics 2 06-18-2012 05:17 AM
Bfast jobs for analyzing AB's SOLiD data vs Illumina data genome_anawk1 Bioinformatics 1 08-24-2011 09:05 AM
how to do alignment for SOLiD data bobo xin SOLiD 3 08-01-2011 05:32 PM
SOCS: Efficient mapping of Applied Biosystems SOLiD sequence data to a ref genome... ECO Literature Watch 0 10-20-2008 07:53 PM
ZOOM released (supporting both Illumina data and ABI SOLiD data) spirit Bioinformatics 2 08-21-2008 06:48 AM

Reply
 
Thread Tools
Old 12-24-2013, 04:23 PM   #1
slowsmile
Member
 
Location: long island

Join Date: May 2011
Posts: 22
Default Can Pindel applied to SOLiD data?

Dear All
Just want to know if anyone has relevant experiences in calling INDELS using Pindel on SOLiD data. We used Pindel on Illumina samples (bam files) with good outcome but now when we moved to SOLid data (bam files, already mapped to reference genome), all I got are empty output files

I have very little experience with SOLiD data, can anyone share with me your experience in applying Pindel to SOLiD data? What procedure did u go through to get the results?
Thanks
slowsmile is offline   Reply With Quote
Old 12-27-2013, 07:06 AM   #2
KaiYe
Senior Member
 
Location: amsterdam

Join Date: Jun 2009
Posts: 133
Default

Quote:
Originally Posted by slowsmile View Post
Dear All
Just want to know if anyone has relevant experiences in calling INDELS using Pindel on SOLiD data. We used Pindel on Illumina samples (bam files) with good outcome but now when we moved to SOLid data (bam files, already mapped to reference genome), all I got are empty output files

I have very little experience with SOLiD data, can anyone share with me your experience in applying Pindel to SOLiD data? What procedure did u go through to get the results?
Thanks
Pindel expects the read orientation as in Illumina paired-end. There is one sam2pindel program to handle SOLiD data but performance is not guaranteed to be optimal.
KaiYe is offline   Reply With Quote
Old 01-01-2014, 07:26 PM   #3
slowsmile
Member
 
Location: long island

Join Date: May 2011
Posts: 22
Default

Thanks Kaiye for your suggestion

However, I am still unable to convert the SoLID bam files into Pindel compatible format with the sam2pindel function. The reads in my SoLID bam file looks like this:

Quote:
475_151_1990 0 chr1 10108 38 72M3H * 0 0 CAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCCTAACCCTAACCCTAACCCTNNCCCTAACC [email protected]@>@[email protected][email protected]@@[email protected][email protected]@??>>>=<<=>>>==>>>>===>>>>==>>>>==>5440'-7710576888 BD:Z:SSTSYVXWVVVRTSRSTQSRQRSPSRQRSPSRQRSPSRQRSPPSRQRSPSRQRSPRQPRSPSRSTUTWSRST PG:Z:MarkDuplicates RG:Z:ugc_509_10_10 NH:i:50 BI:Z:VVUVYWZXVWVSUUTVVTWUTUVSWTTUVTWTTVVTVTSUUSSVTSUUSVTSUUSVTRSSRTWYYYWZUTVV CM:i:1 NM:i:0 CQ:Z:@@>@@@@@@@@@@@@@@@@@@@[email protected][email protected]>@;8=>;?/2/66622/2<836/2222;//<82</6/82//[email protected]>8/ CS:Z:T210100230100230100230100230100230100230100023010023010023010022010023010023
407_312_991 0 chr1 10140 2 39M36H * 0 0 ACCCTAACCCCTAACCCTAACCCTAACCCTAACCCTAAC [email protected][email protected]@@@@[email protected]@[email protected]@[email protected][email protected]>>><<==>>==>>2+ BD:Z:SSTQYXVWXTSUSRSTQTRQRSPSRQRSPSRQRSPTSRS PG:Z:MarkDuplicates RG:Z:ugc_509_10_10 NH:i:50 BI:Z:VVVTZXWYXUTVSTVVTWUTVUTVUSVUTWUSVVTWUTV CM:i:0 NM:i:0 CQ:Z:@@@@@@@@@@@[email protected]@66>[email protected]@/@<[email protected]@8<@/[email protected]/62/28/2/////<68/;//62////////;2///2/88= CS:Z:T310023010002301002301002301002301002301100300103330103330300133112133002133
I tried "samtools view -h input.bam | ./sam2pindel - output.pindel 250 sample 0"
and the output "output.pindel" contain 0 reads somehow

I even tried the newer version of sam2pindel with the "Illumina-PairEnd" at the end, it still generates 0 reads in the output file

Any suggestion?
Thank you
slowsmile is offline   Reply With Quote
Reply

Tags
pindel, solid

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 03:20 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO