SEQanswers

Go Back   SEQanswers > Applications Forums > Sample Prep / Library Generation



Similar Threads
Thread Thread Starter Forum Replies Last Post
MiSeq Pooling\multiplexing 240 samples using Nextera v2 Index elximo Illumina/Solexa 10 10-18-2017 07:38 AM
How to mix single index and dual index TruSeq libraries pmiguel Illumina/Solexa 31 05-24-2017 03:10 AM
Dual-index vs single index Ingeneious Illumina/Solexa 4 01-19-2015 11:22 AM
Mixing dual and single index TruSeq samples in a single MiSeq run pmiguel Illumina/Solexa 1 12-21-2012 05:21 AM
New dual index Nextera TruSeq adapter sequences? koadman Illumina/Solexa 3 08-29-2012 05:17 PM

Reply
 
Thread Tools
Old 05-08-2017, 04:32 AM   #1
Carosmile
Junior Member
 
Location: TX

Join Date: May 2017
Posts: 1
Default Pooling TruSeq (single index) and Nextera XT (dual index) in one MiSeq run?

Hi everyone,

It is my first time posting on this forum. I was wondering if someone has mixed libraries prepared using Nextera XT and TruSeq LT in a single pair-end MiSeq run. Although Illumina's official answer is that they do not recommend it, tech support says that other people are doing it successfully.

This is my first time doing it and I have a couple of questions:

- I have been looking at the Nextera tagmetation reads/adapters and comparing them to the Illumina TruSeq reads. Do both sets of primers come in the reagent cartridge? I don't see how they can be sequenced with the same primers.... am I missing something?

According to Illumina the sequence of the adapters is

Nextera Transposase Adapters

Read 1
5 TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
Read 2
5 GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG

Nextera Index Kit PCR Primers
Index 1 Read
5 CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG
Index 2 Read
5 AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC


The TruSeq adapter/spacer sequences are

Universal Adapter
5 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT

TruSeq Adapter, Index 1
5 GATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG


- From the setup, I understand that the Nextera i7 barcodes are sequenced at the same time than the Truseq 6-base barcodes. Are there any incompatibility issues with the i7 indexes and the Truseq indexes that will prevent me from demultiplexing correctly when I get my sequences back? How many base pairs have to be different in order for us to differentiate the reads from one another?

- The libraries prepared with Nextera have a wider range of fragments (a wider area under the curve as per bioanalyzer) as well as a smaller average insert size than the libraries prepared with the TruSeq kit. I understand that there is a bias towards smaller fragments binding to the flow cell that will be reflected on the coverage per library. Is there a way to correct for that before pooling?


Thanks you all so much for your help!

Carolina
Carosmile is offline   Reply With Quote
Old 05-16-2017, 01:13 PM   #2
pmiguel
Senior Member
 
Location: Purdue University, West Lafayette, Indiana

Join Date: Aug 2008
Posts: 2,291
Default

We do this and it works fine.

Details available in this thread.

--
Phillip
pmiguel is offline   Reply With Quote
Reply

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 04:28 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2018, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO