HiSeq X run: i5 index is reverse complement of i7??

[bmreilly]

Hello, I'm puzzled over an issue we are having with an Illumina HiSeq x run we completed recently for a number of reasons.

We were following the protocol for bisulfite padlock probe sequencing which we have completed successfully recently on a novaSeq 6000 without issue.

This time, unbenknownst to us, the company sequenced our libraries on a HiSeq X, which has different chemistry, and we had serious issues with the index reads.

the i7 read seems to have read correctly, but the i5 reads are all very strange, and very few reads actually demultiplexed to the i5 indexes that we used. When troubleshooting we found that many of the i5 indexes with the highest reads assigned were actually the exact reverse complement of the i7 index for those reads. Many other i5 index reads appear to be random sequences not used in indexes.

Has anyone ever heard of an issue like this? I'm at my wits end here.

[jdk787]

The I5 index chemistry for the HiSeqX is different from the NovaSeq. For standard TruSeq style adapters the I5 sequence on the HiSeqX will be the reverse complement of what it is for the NovaSeq.

If your I5 sequences aren't showing up as the reverse complement, my guess is that your adapters/primers don't have an I5 primer binding site that is compatible with the HiSeqX.

https://support.illumina.com/content/dam/illumina-support/documents/documentation/system_documentation/miseq/indexed-sequencing-overview-guide-15057455-04.pdf

[bmreilly]

The I5 index chemistry for the HiSeqX is different from the NovaSeq. For standard TruSeq style adapters the I5 sequence on the HiSeqX will be the reverse complement of what it is for the NovaSeq.

If your I5 sequences aren't showing up as the reverse complement, my guess is that your adapters/primers don't have an I5 primer binding site that is compatible with the HiSeqX.

https://support.illumina.com/content...5057455-04.pdf

What do you mean by "your adapters/primers don't have an I5 primer binding site that is compatible with the HiSeqX" ? is it possible for these same libraries and primers to work on the NovaSeq but be completely incompatible on the HiSeqX?

I know that you need an i5 primer for the HiSeq X which wouldn't be necessary on the novaseq because the nova has the grafted p5 oligo, but its unclear to me whether if you used the standard HP11 or whatever i5 index primer why it wouldn't work on the HiSeq X?

[jdk787]

What do you mean by "your adapters/primers don't have an I5 primer binding site that is compatible with the HiSeqX" ? is it possible for these same libraries and primers to work on the NovaSeq but be completely incompatible on the HiSeqX?

Yes, I have actually designed custom dual index primers that work on our MiSeq (NovaSeq style) but not on our MiniSeq (HiSeqX style).

I know that you need an i5 primer for the HiSeq X which wouldn't be necessary on the novaseq because the nova has the grafted p5 oligo, but its unclear to me whether if you used the standard HP11 or whatever i5 index primer why it wouldn't work on the HiSeq X?

I would first look at your I5 oligo sequence and compare it to Illumina's.

https://support.illumina.com/content/dam/illumina-support/documents/documentation/chemistry_documentation/experiment-design/illumina-adapter-sequences-1000000002694-09.pdf

TruSeq
AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTCCCTACACGACGCTCTTCCGATCT

Nextera
AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC

If it matches one of these then you should be fine, but if not your oligo may not be compatible with platforms that use the same index chemistry as the HiSeqX.