
Go Back   SEQanswers > Bioinformatics > Bioinformatics

Similar Threads
Thread Thread Starter Forum Replies Last Post
MACS version 1.3.0 versus MACS version 1.4.0 neetu Bioinformatics 1 11-24-2011 03:13 AM
MACS 1.4.0beta iros.barozzi Bioinformatics 3 05-19-2011 01:38 PM
MACS wignorm command gzentner Bioinformatics 0 03-05-2011 05:03 PM
MACS peaks VeenaV Bioinformatics 2 11-10-2010 08:46 AM
Column order in samfiles in consensus calling KevinLam Bioinformatics 1 07-28-2010 09:05 AM

Thread Tools
Old 12-17-2010, 05:26 AM   #1
Location: Oslo

Join Date: Dec 2010
Posts: 15
Question MACS SAMfiles

I've used MACS to find peaks in a SAM file, and I got a line in the peaks.bed file in SAM with negative start (-98) so I cannot upload the file in UCSC genome browser.
chrM -98 4052 macs_PEAK_50677 971.81
Does somebody understand the reason for this output? Is there a bug in MACS when it finds hits the negative strand?
khb is offline   Reply With Quote
Old 12-17-2010, 01:01 PM   #2
Location: New York, NY

Join Date: Dec 2010
Posts: 25

Hi khb,

What software did you use to produce the alignment? Can you post some of the reads mapping to chrM?

polyatail is offline   Reply With Quote
Old 12-19-2010, 09:37 AM   #3
Location: Oslo

Join Date: Dec 2010
Posts: 15

I used bowtie.
Here is some of the output from bowtie
HWUSI-EAS1525_0005_FC:4:1:7582:8004#0/1 - chrM 313 CCCCGCTTCTGGCCACAGCACTTAAACACATCTCTGCCAAACCCCAAAAA cgcag_^^^[X_LXV]ggggcfccfX_YZZQdbdb_afffdfcffggggg 0
HWUSI-EAS1525_0005_FC:4:1:15912:8129#0/1 - chrM 14456 ATCGCTGTAGTATATCCAAAGACAACCATCATTCCCCCTAAATAAATTAA afhhhfhhghhhhfhhhhhhgghhhfghghhghhhhhhhhhhhhhhhhgh 0
HWUSI-EAS1525_0005_FC:4:1:13895:8331#0/1 + chrM 3185 ATCTCAACTTAGTATTATACCCACACCCACCCAAGAACAGGGTTTGTTAA ggggcgggggffdcffdfffgggggggggggggggffgggfdafffeccd 0
HWUSI-EAS1525_0005_FC:4:1:10583:8537#0/1 - chrM 12329 TAAAAGTAATAACCATGCACACTACTATAACCACCCTAACCCTAACTTCC gfgggggggggdgggeffefaffafadde\_d^eefffafffffcebbee 0 6:G>A
HWUSI-EAS1525_0005_FC:4:1:14677:8853#0/1 - chrM 11331 CCAACAACTTAATATGACTAGCTTACACAATAGCTTTTATAGTAAAGATA ]adcffeffcffcfffcddffcfcdedeee[afcffcffcffdcffffcf 0
HWUSI-EAS1525_0005_FC:4:1:19550:9039#0/1 + chrM 3344 TTCTAATCGCAATGGCATTCCTAATGCTTACCGAACGAAAAATTCTAGGC hhhhhhhhhhhghghehgghhhhhghfhghhg_hhfcfefgdfffcfdcc 0
HWUSI-EAS1525_0005_FC:4:1:5655:9204#0/1 + chrM 13011 CCAATTAGGTCTCCACCCCTGACTCCCCTCAGCCATAGAAGGCCCCACCC hhhhhhghhhhhhhhhhhhghghhhgahgh_ffcchhhhfhchgghhh`h 0
HWUSI-EAS1525_0005_FC:4:1:3891:9219#0/1 - chrM 12759 CATCGGCTGAGAGGGCGTAGGAATTATATCCTTCTTGCTCATCAGTTGAT ccffdagggggddgegffgggggggggffgffffdgfecfcggggggggg 0
HWUSI-EAS1525_0005_FC:4:1:10936:9386#0/1 - chrM 511 CCAGCACACACACACCGCTGCTAACCCCATACCCCGAACCAACCAAACCC c[^Y^T[T[Wb]bTbf[feeb`d_ecffdb]deeefff_fafffff`eff 0
HWUSI-EAS1525_0005_FC:4:1:5529:9413#0/1 + chrM 595 CCTCAAAGCAATACACTGAAAATGTTTAGACGGGCTCACATCACCCCATA hhhhhhghhfhhhghhhhhhhhhhhhhhhhghhhfghhhhhhhhhhhhfh 0
HWUSI-EAS1525_0005_FC:4:1:10410:9859#0/1 + chrM 10090 CCCTCCTAGCCTTACTACTAATAATTATTACATTTTGACTACCACAACTC gggfgfcffafffdff_fcfffddffffffggfggfa]fcfefcfaffec 0


Last edited by khb; 12-19-2010 at 09:25 PM.
khb is offline   Reply With Quote

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off

All times are GMT -8. The time now is 03:01 AM.

Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2020, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO