Doing PCR enrichment on PCR-free TruSeq lib?

[JBKri]

I am making a contingency plan in case our next TruSeq (DNA) PCR-free libraries don't have sufficient yield. As far as I can tell the only difference between TruSeq PCR-free and TruSeq Nano is the DNA input amount and the lack of PCR enrichment at the end of the PCR-free protocol. So if we end up with too low yield it should be possible to do some PCR-cycles with the primers here: http://bioinformatics.cvr.ac.uk/blog...mer-sequences/ :
PCR Primer 1.0 (P5)
5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGA 3’
and
PCR Primer 2.0 (P7)
5’ CAAGCAGAAGACGGCATACGAGAT 3’

Further, I was thinking we probably have these primers in leftovers from another kit, in the "PCR Primer Cocktail" from a TruSeq stranded mRNA kit. Can anyone confirm this? From the same kit we have only a small amount of PCR Master Mix, so we are thinking to use KAPA HiFi mix instead. Does anyone have an idea of the annealing temperature to use?

[kerplunk412]

Your plan sounds perfect. You can probably find a Kapa library prep protocol on their website, so you can use the PCR conditions from that. I think they are something like 98 degree melt and 65 degree anneal. Also, you should be checking the concentration of your PCR-free libraries by QPCR, so the primers from that kit should work as well.

[JBKri]

Originally Posted by kerplunk412

Your plan sounds perfect. You can probably find a Kapa library prep protocol on their website, so you can use the PCR conditions from that. I think they are something like 98 degree melt and 65 degree anneal. Also, you should be checking the concentration of your PCR-free libraries by QPCR, so the primers from that kit should work as well.

Thanks. But the primers aren't supplied separately in the qPCR kit we use.

I realized the KAPA documentation specifies the primer sequences in the mix, and they are shorter than those above, especially Primer 1. I don't understand why the P5 primer above is so long. I'll try the KAPA primers and conditions.
Jon