SEQanswers

Go Back   SEQanswers > Applications Forums > Sample Prep / Library Generation

Similar Threads
Thread Thread Starter Forum Replies Last Post
TruSeq PCR-Free odd peaks aaronh Sample Prep / Library Generation 1 08-15-2014 09:30 PM
Nextera XT vs TruSeq PCR free vl80 Sample Prep / Library Generation 1 06-09-2014 02:13 AM
TruSeq PCR-free transition avo Sample Prep / Library Generation 2 03-05-2014 03:45 AM
Truseq DNA PCR-free kit Laruo Sample Prep / Library Generation 1 03-05-2014 03:42 AM
Lib prep - Splitting PCR to reduce PCR bias prepagam Illumina/Solexa 2 03-15-2013 04:30 PM

Reply
 
Thread Tools
Old 10-05-2015, 03:05 AM   #1
JBKri
Member
 
Location: Heraklion, Greece

Join Date: Jan 2014
Posts: 79
Default Doing PCR enrichment on PCR-free TruSeq lib?

I am making a contingency plan in case our next TruSeq (DNA) PCR-free libraries don't have sufficient yield. As far as I can tell the only difference between TruSeq PCR-free and TruSeq Nano is the DNA input amount and the lack of PCR enrichment at the end of the PCR-free protocol. So if we end up with too low yield it should be possible to do some PCR-cycles with the primers here: http://bioinformatics.cvr.ac.uk/blog...mer-sequences/ :
PCR Primer 1.0 (P5)
5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGA 3’
and
PCR Primer 2.0 (P7)
5’ CAAGCAGAAGACGGCATACGAGAT 3’

Further, I was thinking we probably have these primers in leftovers from another kit, in the "PCR Primer Cocktail" from a TruSeq stranded mRNA kit. Can anyone confirm this? From the same kit we have only a small amount of PCR Master Mix, so we are thinking to use KAPA HiFi mix instead. Does anyone have an idea of the annealing temperature to use?
JBKri is offline   Reply With Quote
Old 10-05-2015, 04:17 PM   #2
kerplunk412
Senior Member
 
Location: Bioo Scientific, Austin, TX, USA

Join Date: Jun 2012
Posts: 119
Default

Your plan sounds perfect. You can probably find a Kapa library prep protocol on their website, so you can use the PCR conditions from that. I think they are something like 98 degree melt and 65 degree anneal. Also, you should be checking the concentration of your PCR-free libraries by QPCR, so the primers from that kit should work as well.
kerplunk412 is offline   Reply With Quote
Old 10-08-2015, 08:00 AM   #3
JBKri
Member
 
Location: Heraklion, Greece

Join Date: Jan 2014
Posts: 79
Default

Quote:
Originally Posted by kerplunk412 View Post
Your plan sounds perfect. You can probably find a Kapa library prep protocol on their website, so you can use the PCR conditions from that. I think they are something like 98 degree melt and 65 degree anneal. Also, you should be checking the concentration of your PCR-free libraries by QPCR, so the primers from that kit should work as well.

Thanks. But the primers aren't supplied separately in the qPCR kit we use.

I realized the KAPA documentation specifies the primer sequences in the mix, and they are shorter than those above, especially Primer 1. I don't understand why the P5 primer above is so long. I'll try the KAPA primers and conditions.
Jon
JBKri is offline   Reply With Quote
Reply

Tags
pcr-free, truseq, truseq nano

Thread Tools

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

BB code is On
Smilies are On
[IMG] code is On
HTML code is Off




All times are GMT -8. The time now is 12:08 PM.


Powered by vBulletin® Version 3.8.9
Copyright ©2000 - 2021, vBulletin Solutions, Inc.
Single Sign On provided by vBSSO