Custom primers for NextSeq: will they work on MiSeq and HiSeq?

rudzik79 · 07-21-2017, 02:20 AM

I am wondering whether my experiment (which was originally designed to work on a NextSeq) will work on MiSeq and HiSeq.

It is a library prepared with MIP technique and the PCR primers are

CAAGCAGAAGACGGCATACGAGATNNNNNNNNACACGCACGATCCGACGGTAGTGT
AATGATACGGCGACCACCGAGATCTACACATACGAGATCCGTAATCGGGAAGCTGAAG

My sequencing primers:

FOR CATACGAGATCCGTAATCGGGAAGCTGAAG C
REV ACACGCACGATCCGACGGTAGTGT A
INDX ACACTACCGTCGGATCGTGCGTGT A

I would be grateful for a quick response

Anna

SNPsaurus · 07-21-2017, 08:00 PM

We use custom primers and run libraries on NextSeq and HiSeq. MiSeq has a higher temperature for binding so a given primer may not work on MiSeq.

rudzik79 · 07-23-2017, 06:46 AM

Thanks for your reply!
OK, now, how do I check that? What are the boundaries for Tm for MiSeq, NextSeq and HiSeq?

Similar Threads
Thread	Thread Starter	Forum	Replies	Last Post
Nextera Miseq custom primers	adziulko	Illumina/Solexa	1	05-19-2017 09:31 PM
Custom primers and PhiX on MiSeq	gleb	Illumina/Solexa	14	05-09-2017 09:53 AM
Has the NextSeq forgotten how to use custom primers?	jwfoley	Illumina/Solexa	2	04-08-2015 11:35 PM
miseq custom primers	barturas	Illumina/Solexa	1	07-01-2013 06:46 AM

07-21-2017, 02:20 AM	#1
rudzik79 Member Location: Poland Join Date: May 2016 Posts: 10	Custom primers for NextSeq: will they work on MiSeq and HiSeq? I am wondering whether my experiment (which was originally designed to work on a NextSeq) will work on MiSeq and HiSeq. It is a library prepared with MIP technique and the PCR primers are CAAGCAGAAGACGGCATACGAGATNNNNNNNNACACGCACGATCCGACGGTAGTGT AATGATACGGCGACCACCGAGATCTACACATACGAGATCCGTAATCGGGAAGCTGAAG My sequencing primers: FOR CATACGAGATCCGTAATCGGGAAGCTGAAG C REV ACACGCACGATCCGACGGTAGTGT A INDX ACACTACCGTCGGATCGTGCGTGT A I would be grateful for a quick response Anna

07-21-2017, 08:00 PM	#2
SNPsaurus Registered Vendor Location: Eugene, OR Join Date: May 2013 Posts: 521	We use custom primers and run libraries on NextSeq and HiSeq. MiSeq has a higher temperature for binding so a given primer may not work on MiSeq. __________________ Providing nextRAD genotyping and PacBio sequencing services. http://snpsaurus.com

07-23-2017, 06:46 AM	#3
rudzik79 Member Location: Poland Join Date: May 2016 Posts: 10	Thanks for your reply! OK, now, how do I check that? What are the boundaries for Tm for MiSeq, NextSeq and HiSeq?